EMAIL THIS PAGE TO A FRIEND

DAPL1

death associated protein-like 1

44 Gene Product Result for
UniProtKB ID: A0PJW8, A0PJW9, B9EIK6
Gene ID:
Mouse(76747) death associated protein-like 1
Rat(362136) death associated protein-like 1
domestic cat(101092453) death associated protein-like 1
cow(574085) death associated protein-like 1
dog(607792) death associated protein-like 1
naked mole-rat(101706894) death associated protein-like 1
domestic guinea pig(100719926) death associated protein-like 1
sheep(101111778) death associated protein-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017920 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017920 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017920 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055601 MISSION® esiRNA esiRNA human DAPL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017920 Rosetta Predictions human pricing
NM_001108582 Rosetta Predictions rat pricing
NM_029723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017920 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142681 predicted 266
2 SASI_Hs01_00142683 predicted 232
3 SASI_Hs01_00142684 predicted 295
4 SASI_Hs01_00142685 predicted 268
5 SASI_Hs01_00142686 predicted 234
6 SASI_Hs01_00142687 predicted 267
7 SASI_Hs01_00142689 predicted 240
8 SASI_Hs01_00142690 predicted 228
9 SASI_Hs02_00306803 predicted 290
10 SASI_Hs02_00306804 predicted 239
11 SASI_Hs01_00142682 predicted 245
12 SASI_Hs01_00142688 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108582 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240059 predicted 465
2 SASI_Rn02_00240060 predicted 340
3 SASI_Rn02_00240061 predicted 418
4 SASI_Rn02_00240062 predicted 257
5 SASI_Rn02_00240063 predicted 255
6 SASI_Rn02_00240064 predicted 420
7 SASI_Rn02_00240065 predicted 209
8 SASI_Rn02_00240066 predicted 501
9 SASI_Rn02_00240067 predicted 283
10 SASI_Rn02_00240068 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110131 predicted 201
2 SASI_Mm01_00110132 predicted 193
3 SASI_Mm01_00110133 predicted 203
4 SASI_Mm01_00110134 predicted 201
5 SASI_Mm02_00335811 predicted 276
6 SASI_Mm01_00110136 predicted 330
7 SASI_Mm01_00110137 predicted 249
8 SASI_Mm01_00110138 predicted 206
9 SASI_Mm01_00110139 predicted 241
10 SASI_Mm01_00110140 predicted 246
11 SASI_Mm01_00110135 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017920
DAPL1 MISSION shRNA Bacterial Glycerol Stock
death associated protein-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017920.1-389s1c1
Sequence:CCGGCGTCTGGCCAGCTGCCTCGAACTCGAGTTCGAGGCAGCTGGCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-241s1c1
Sequence:CCGGCACTGGAGAAGCTCAACTATACTCGAGTATAGTTGAGCTTCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-340s1c1
Sequence:CCGGACATTATTCAGCAGCCTCGAACTCGAGTTCGAGGCTGCTGAATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-135s1c1
Sequence:CCGGCAAGAAATTGGCACCTTGGAACTCGAGTTCCAAGGTGCCAATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-192s1c1
Sequence:CCGGGCCATTGCAAATGTTGCCAAACTCGAGTTTGGCAACATTTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017920
DAPL1 MISSION shRNA shRNA Plasmid DNA
death associated protein-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017920.1-389s1c1
Sequence:CCGGCGTCTGGCCAGCTGCCTCGAACTCGAGTTCGAGGCAGCTGGCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-241s1c1
Sequence:CCGGCACTGGAGAAGCTCAACTATACTCGAGTATAGTTGAGCTTCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-340s1c1
Sequence:CCGGACATTATTCAGCAGCCTCGAACTCGAGTTCGAGGCTGCTGAATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-135s1c1
Sequence:CCGGCAAGAAATTGGCACCTTGGAACTCGAGTTCCAAGGTGCCAATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-192s1c1
Sequence:CCGGGCCATTGCAAATGTTGCCAAACTCGAGTTTGGCAACATTTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017920
DAPL1 MISSION shRNA Lentiviral Transduction Particles
death associated protein-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017920.1-389s1c1
Sequence:CCGGCGTCTGGCCAGCTGCCTCGAACTCGAGTTCGAGGCAGCTGGCCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-241s1c1
Sequence:CCGGCACTGGAGAAGCTCAACTATACTCGAGTATAGTTGAGCTTCTCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-340s1c1
Sequence:CCGGACATTATTCAGCAGCCTCGAACTCGAGTTCGAGGCTGCTGAATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-135s1c1
Sequence:CCGGCAAGAAATTGGCACCTTGGAACTCGAGTTCCAAGGTGCCAATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017920.1-192s1c1
Sequence:CCGGGCCATTGCAAATGTTGCCAAACTCGAGTTTGGCAACATTTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029723
DAPL1 MISSION shRNA Bacterial Glycerol Stock
death associated protein-like 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-283s1c1
Sequence:CCGGCAGTTCACACGGCACATCAAACTCGAGTTTGATGTGCCGTGTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-202s1c1
Sequence:CCGGCCATCACAAATGTCGCCAAGACTCGAGTCTTGGCGACATTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029723.1-216s1c1
Sequence:CCGGGCCAAGATACAGATGTTGGATCTCGAGATCCAACATCTGTATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-221s1c1
Sequence:CCGGGATACAGATGTTGGATGCTCTCTCGAGAGAGCATCCAACATCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-203s1c1
Sequence:CCGGCATCACAAATGTCGCCAAGATCTCGAGATCTTGGCGACATTTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-267s1c1
Sequence:CCGGCATAAATTTCCAGCGACAGTTCTCGAGAACTGTCGCTGGAAATTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029723
DAPL1 MISSION shRNA shRNA Plasmid DNA
death associated protein-like 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-283s1c1
Sequence:CCGGCAGTTCACACGGCACATCAAACTCGAGTTTGATGTGCCGTGTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-202s1c1
Sequence:CCGGCCATCACAAATGTCGCCAAGACTCGAGTCTTGGCGACATTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029723.1-216s1c1
Sequence:CCGGGCCAAGATACAGATGTTGGATCTCGAGATCCAACATCTGTATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-221s1c1
Sequence:CCGGGATACAGATGTTGGATGCTCTCTCGAGAGAGCATCCAACATCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-203s1c1
Sequence:CCGGCATCACAAATGTCGCCAAGATCTCGAGATCTTGGCGACATTTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-267s1c1
Sequence:CCGGCATAAATTTCCAGCGACAGTTCTCGAGAACTGTCGCTGGAAATTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029723
DAPL1 MISSION shRNA Lentiviral Transduction Particles
death associated protein-like 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-283s1c1
Sequence:CCGGCAGTTCACACGGCACATCAAACTCGAGTTTGATGTGCCGTGTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-202s1c1
Sequence:CCGGCCATCACAAATGTCGCCAAGACTCGAGTCTTGGCGACATTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029723.1-216s1c1
Sequence:CCGGGCCAAGATACAGATGTTGGATCTCGAGATCCAACATCTGTATCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-221s1c1
Sequence:CCGGGATACAGATGTTGGATGCTCTCTCGAGAGAGCATCCAACATCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-203s1c1
Sequence:CCGGCATCACAAATGTCGCCAAGATCTCGAGATCTTGGCGACATTTGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029723.1-267s1c1
Sequence:CCGGCATAAATTTCCAGCGACAGTTCTCGAGAACTGTCGCTGGAAATTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks