EMAIL THIS PAGE TO A FRIEND

DAPP1

dual adaptor of phosphotyrosine and 3-phosphoinositides

Synonyms: BAM32
UniProtKB ID: Q9UN19, Q8TCK5, Q9UHF2
Gene ID:
Mouse(26377) dual adaptor for phosphotyrosine and 3-phosphoinositides 1
Rat(362046) dual adaptor of phosphotyrosine and 3-phosphoinositides
sheep(101110675) dual adaptor of phosphotyrosine and 3-phosphoinositides
domestic guinea pig(100734806) dual adaptor of phosphotyrosine and 3-phosphoinositides
naked mole-rat(101701948) dual adaptor of phosphotyrosine and 3-phosphoinositides
Zebrafish(550386) dual adaptor of phosphotyrosine and 3-phosphoinositides
chicken(425211) dual adaptor of phosphotyrosine and 3-phosphoinositides
cow(533156) dual adaptor of phosphotyrosine and 3-phosphoinositides
dog(478491) dual adaptor of phosphotyrosine and 3-phosphoinositides
domestic cat(101099635) dual adaptor of phosphotyrosine and 3-phosphoinositides
82 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501897 Anti-DAPP1 (C-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
GW21544 Anti-DAPP1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501689 Anti-DAPP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, human, bovine
ELISA, western blot pricing
SAB1407332 Anti-DAPP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2105948 Anti-DAPP1 antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, horse, human
western blot pricing
SAB2105949 Anti-DAPP1 antibody produced in rabbit affinity isolated antibody guinea pig, human, horse, rabbit
western blot pricing
HPA046074 Anti-DAPP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501192 Anti-DAPP1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4504165 Anti-phospho-DAPP1 (pTyr139) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB1401634 Monoclonal Anti-DAPP1 antibody produced in mouse clone 1E1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014395 Rosetta Predictions human pricing
NM_001108568 Rosetta Predictions rat pricing
NM_011932 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141042 predicted 636
2 SASI_Hs01_00141043 predicted 483
3 SASI_Hs01_00141044 predicted 417
4 SASI_Hs01_00141045 predicted 324
5 SASI_Hs01_00141046 predicted 745
6 SASI_Hs02_00345581 predicted 913
7 SASI_Hs01_00141047 predicted 657
8 SASI_Hs01_00141048 predicted 308
9 SASI_Hs01_00141049 predicted 714
10 SASI_Hs01_00141050 predicted 698
11 SASI_Hs01_00141041 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239919 predicted 435
2 SASI_Rn02_00239920 predicted 775
3 SASI_Rn02_00239921 predicted 367
4 SASI_Rn02_00239922 predicted 370
5 SASI_Rn02_00239923 predicted 707
6 SASI_Rn02_00239924 predicted 336
7 SASI_Rn02_00239925 predicted 1009
8 SASI_Rn02_00239926 predicted 501
9 SASI_Rn02_00239927 predicted 380
10 SASI_Rn02_00239928 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011932 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104310 predicted 523
2 SASI_Mm01_00104311 predicted 732
3 SASI_Mm01_00104312 predicted 464
4 SASI_Mm01_00104314 predicted 292
5 SASI_Mm01_00104315 predicted 811
6 SASI_Mm01_00104316 predicted 408
7 SASI_Mm01_00104317 predicted 944
8 SASI_Mm02_00321764 predicted 405
9 SASI_Mm02_00321765 predicted 390
10 SASI_Mm02_00321766 predicted 365
11 SASI_Mm01_00104309 predicted 1015
12 SASI_Mm01_00104313 predicted 372
13 SASI_Mm01_00104318 predicted 525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011932
DAPP1 MISSION shRNA Bacterial Glycerol Stock
dual adaptor of phosphotyrosine and 3-phosphoinositides
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011932.1-1779s1c1
Sequence:CCGGCGTCTAATGATAAACTGAGAACTCGAGTTCTCAGTTTATCATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-918s1c1
Sequence:CCGGCGTCCGATCTAGGTCATTTATCTCGAGATAAATGACCTAGATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-833s1c1
Sequence:CCGGCGGGAGTTGAAGCCGATGAATCTCGAGATTCATCGGCTTCAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-386s1c1
Sequence:CCGGTCGGCTTTAATGAGTATTCATCTCGAGATGAATACTCATTAAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-372s1c1
Sequence:CCGGGTACTCGTTTAAATTCGGCTTCTCGAGAAGCCGAATTTAAACGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011932.2-1254s21c1
Sequence:CCGGAGGCTCATTGACTTTAGTTTCCTCGAGGAAACTAAAGTCAATGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011932.2-1369s21c1
Sequence:CCGGGGCTTTAGGAAGCAGATTAATCTCGAGATTAATCTGCTTCCTAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011932
DAPP1 MISSION shRNA shRNA Plasmid DNA
dual adaptor of phosphotyrosine and 3-phosphoinositides
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011932.1-1779s1c1
Sequence:CCGGCGTCTAATGATAAACTGAGAACTCGAGTTCTCAGTTTATCATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-918s1c1
Sequence:CCGGCGTCCGATCTAGGTCATTTATCTCGAGATAAATGACCTAGATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-833s1c1
Sequence:CCGGCGGGAGTTGAAGCCGATGAATCTCGAGATTCATCGGCTTCAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-386s1c1
Sequence:CCGGTCGGCTTTAATGAGTATTCATCTCGAGATGAATACTCATTAAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-372s1c1
Sequence:CCGGGTACTCGTTTAAATTCGGCTTCTCGAGAAGCCGAATTTAAACGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011932.2-1254s21c1
Sequence:CCGGAGGCTCATTGACTTTAGTTTCCTCGAGGAAACTAAAGTCAATGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011932.2-1369s21c1
Sequence:CCGGGGCTTTAGGAAGCAGATTAATCTCGAGATTAATCTGCTTCCTAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011932
DAPP1 MISSION shRNA Lentiviral Transduction Particles
dual adaptor of phosphotyrosine and 3-phosphoinositides
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011932.1-1779s1c1
Sequence:CCGGCGTCTAATGATAAACTGAGAACTCGAGTTCTCAGTTTATCATTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-918s1c1
Sequence:CCGGCGTCCGATCTAGGTCATTTATCTCGAGATAAATGACCTAGATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-833s1c1
Sequence:CCGGCGGGAGTTGAAGCCGATGAATCTCGAGATTCATCGGCTTCAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-386s1c1
Sequence:CCGGTCGGCTTTAATGAGTATTCATCTCGAGATGAATACTCATTAAAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011932.1-372s1c1
Sequence:CCGGGTACTCGTTTAAATTCGGCTTCTCGAGAAGCCGAATTTAAACGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011932.2-1254s21c1
Sequence:CCGGAGGCTCATTGACTTTAGTTTCCTCGAGGAAACTAAAGTCAATGAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440521    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011932.2-1369s21c1
Sequence:CCGGGGCTTTAGGAAGCAGATTAATCTCGAGATTAATCTGCTTCCTAAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014395
VALIDATED
DAPP1 MISSION shRNA Bacterial Glycerol Stock
dual adaptor of phosphotyrosine and 3-phosphoinositides
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-301s1c1
Sequence:CCGGGTGAGGGCCAAAGATTCTGTTCTCGAGAACAGAATCTTTGGCCCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-525s1c1
Sequence:CCGGGCAGACAGGAAGAACAGAAGACTCGAGTCTTCTGTTCTTCCTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014395.x-1900s1c1
Sequence:CCGGCAGAATTAGTTGTATAGGGTTCTCGAGAACCCTATACAACTAATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-900s1c1
Sequence:CCGGCGAGGAGAAGACTGATCACAACTCGAGTTGTGATCAGTCTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-799s1c1
Sequence:CCGGTGTGCAAAGACCGGAGTAGAACTCGAGTTCTACTCCGGTCTTTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014395.2-1061s21c1
Sequence:CCGGTGCTGATTGGGACCCATATACCTCGAGGTATATGGGTCCCAATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014395.2-832s21c1
Sequence:CCGGGATGAGTGGATCAAGATATTACTCGAGTAATATCTTGATCCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014395.2-1361s21c1
Sequence:CCGGGATGACTTCTGCAGGATTTATCTCGAGATAAATCCTGCAGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014395.2-732s21c1
Sequence:CCGGAGCTGTACAATTCGATTATTCCTCGAGGAATAATCGAATTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014395
VALIDATED
DAPP1 MISSION shRNA shRNA Plasmid DNA
dual adaptor of phosphotyrosine and 3-phosphoinositides
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-301s1c1
Sequence:CCGGGTGAGGGCCAAAGATTCTGTTCTCGAGAACAGAATCTTTGGCCCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-525s1c1
Sequence:CCGGGCAGACAGGAAGAACAGAAGACTCGAGTCTTCTGTTCTTCCTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014395.x-1900s1c1
Sequence:CCGGCAGAATTAGTTGTATAGGGTTCTCGAGAACCCTATACAACTAATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-900s1c1
Sequence:CCGGCGAGGAGAAGACTGATCACAACTCGAGTTGTGATCAGTCTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-799s1c1
Sequence:CCGGTGTGCAAAGACCGGAGTAGAACTCGAGTTCTACTCCGGTCTTTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014395.2-1061s21c1
Sequence:CCGGTGCTGATTGGGACCCATATACCTCGAGGTATATGGGTCCCAATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014395.2-832s21c1
Sequence:CCGGGATGAGTGGATCAAGATATTACTCGAGTAATATCTTGATCCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014395.2-1361s21c1
Sequence:CCGGGATGACTTCTGCAGGATTTATCTCGAGATAAATCCTGCAGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014395.2-732s21c1
Sequence:CCGGAGCTGTACAATTCGATTATTCCTCGAGGAATAATCGAATTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014395
VALIDATED
DAPP1 MISSION shRNA Lentiviral Transduction Particles
dual adaptor of phosphotyrosine and 3-phosphoinositides
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-301s1c1
Sequence:CCGGGTGAGGGCCAAAGATTCTGTTCTCGAGAACAGAATCTTTGGCCCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-525s1c1
Sequence:CCGGGCAGACAGGAAGAACAGAAGACTCGAGTCTTCTGTTCTTCCTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014395.x-1900s1c1
Sequence:CCGGCAGAATTAGTTGTATAGGGTTCTCGAGAACCCTATACAACTAATTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-900s1c1
Sequence:CCGGCGAGGAGAAGACTGATCACAACTCGAGTTGTGATCAGTCTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002603    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014395.x-799s1c1
Sequence:CCGGTGTGCAAAGACCGGAGTAGAACTCGAGTTCTACTCCGGTCTTTGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014395.2-1061s21c1
Sequence:CCGGTGCTGATTGGGACCCATATACCTCGAGGTATATGGGTCCCAATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014395.2-832s21c1
Sequence:CCGGGATGAGTGGATCAAGATATTACTCGAGTAATATCTTGATCCACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014395.2-1361s21c1
Sequence:CCGGGATGACTTCTGCAGGATTTATCTCGAGATAAATCCTGCAGAAGTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014395.2-732s21c1
Sequence:CCGGAGCTGTACAATTCGATTATTCCTCGAGGAATAATCGAATTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks