EMAIL THIS PAGE TO A FRIEND

DARC

Duffy blood group, atypical chemokine receptor

63 Gene Product Result for
Synonyms: ACKR1 CCBP1 CD234 Dfy FY GPD GpFy WBCQ1
Gene ID:
Human(2532) Summary: The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13349) Duffy blood group, chemokine receptor
Rat(689105) Duffy blood group, atypical chemokine receptor
dog(478969) Duffy blood group, chemokine receptor
cow(528076) Duffy blood group, chemokine receptor
domestic cat(101094569) Duffy blood group, chemokine receptor
sheep(101113185) Duffy blood group, chemokine receptor
naked mole-rat(101702701) Duffy blood group, chemokine receptor
domestic guinea pig(101789008) Duffy blood group, chemokine receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002036 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002036 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002036 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218751 MISSION® esiRNA esiRNA targeting human DARC human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122951 Rosetta Predictions human pricing
NM_002036 Rosetta Predictions human pricing
NM_010045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327557 predicted 716
2 SASI_Hs02_00327558 predicted 602
3 SASI_Hs02_00327559 predicted 605
4 SASI_Hs02_00327560 predicted 682
5 SASI_Hs02_00327561 predicted 589
6 SASI_Hs02_00327562 predicted 819
7 SASI_Hs02_00327563 predicted 612
8 SASI_Hs02_00327564 predicted 350
9 SASI_Hs02_00327565 predicted 424
10 SASI_Hs02_00327566 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055492 predicted 929
2 SASI_Hs01_00055495 predicted 810
3 SASI_Hs01_00055496 predicted 812
4 SASI_Hs01_00055499 predicted 894
5 SASI_Hs02_00333061 predicted 800
6 SASI_Hs02_00333062 predicted 1039
7 SASI_Hs01_00055501 predicted 826
8 SASI_Hs02_00333063 predicted 568
9 SASI_Hs02_00333064 predicted 633
10 SASI_Hs02_00333065 predicted 895
11 SASI_Hs01_00055493 predicted 860
12 SASI_Hs01_00055494 predicted 302
13 SASI_Hs01_00055497 predicted 1009
14 SASI_Hs01_00055498 predicted 879
15 SASI_Hs01_00055500 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136368 predicted 478
2 SASI_Mm02_00317682 predicted 694
3 SASI_Mm02_00317683 predicted 736
4 SASI_Mm02_00317684 predicted 681
5 SASI_Mm01_00136371 predicted 427
6 SASI_Mm02_00317685 predicted 680
7 SASI_Mm01_00136372 predicted 340
8 SASI_Mm02_00317686 predicted 930
9 SASI_Mm01_00136376 predicted 479
10 SASI_Mm02_00317687 predicted 485
11 SASI_Mm01_00136367 predicted 488
12 SASI_Mm01_00136369 predicted 680
13 SASI_Mm01_00136370 predicted 253
14 SASI_Mm01_00136373 predicted 643
15 SASI_Mm01_00136374 predicted 472
16 SASI_Mm01_00136375 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002036
DARC MISSION shRNA Bacterial Glycerol Stock
Duffy blood group, atypical chemokine receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-973s21c1
Sequence:CCGGATCCTGTGGGCCTGGTTTATTCTCGAGAATAAACCAGGCCCACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-818s21c1
Sequence:CCGGGACTCTGCACCCTGATATACACTCGAGTGTATATCAGGGTGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-875s21c1
Sequence:CCGGTAGCCTGTCTTGCCATCTTTGCTCGAGCAAAGATGGCAAGACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-1103s21c1
Sequence:CCGGTGGCAGAAGCCCTGGCAATTTCTCGAGAAATTGCCAGGGCTTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-930s1c1
Sequence:CCGGGCTGAAGAAGGCATTGGGTATCTCGAGATACCCAATGCCTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-874s1c1
Sequence:CCGGGTAGCCTGTCTTGCCATCTTTCTCGAGAAAGATGGCAAGACAGGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-630s1c1
Sequence:CCGGCCTGGGCTACTGTGTCTGGTACTCGAGTACCAGACACAGTAGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-323s1c1
Sequence:CCGGCTTCCTATGGTGTGAATGATTCTCGAGAATCATTCACACCATAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-438s1c1
Sequence:CCGGCCTCACCAGTGTCCTGGGTATCTCGAGATACCCAGGACACTGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002036
DARC MISSION shRNA shRNA Plasmid DNA
Duffy blood group, atypical chemokine receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-973s21c1
Sequence:CCGGATCCTGTGGGCCTGGTTTATTCTCGAGAATAAACCAGGCCCACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-818s21c1
Sequence:CCGGGACTCTGCACCCTGATATACACTCGAGTGTATATCAGGGTGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-875s21c1
Sequence:CCGGTAGCCTGTCTTGCCATCTTTGCTCGAGCAAAGATGGCAAGACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-1103s21c1
Sequence:CCGGTGGCAGAAGCCCTGGCAATTTCTCGAGAAATTGCCAGGGCTTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-930s1c1
Sequence:CCGGGCTGAAGAAGGCATTGGGTATCTCGAGATACCCAATGCCTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-874s1c1
Sequence:CCGGGTAGCCTGTCTTGCCATCTTTCTCGAGAAAGATGGCAAGACAGGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-630s1c1
Sequence:CCGGCCTGGGCTACTGTGTCTGGTACTCGAGTACCAGACACAGTAGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-323s1c1
Sequence:CCGGCTTCCTATGGTGTGAATGATTCTCGAGAATCATTCACACCATAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-438s1c1
Sequence:CCGGCCTCACCAGTGTCCTGGGTATCTCGAGATACCCAGGACACTGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002036
DARC MISSION shRNA Lentiviral Transduction Particles
Duffy blood group, atypical chemokine receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-973s21c1
Sequence:CCGGATCCTGTGGGCCTGGTTTATTCTCGAGAATAAACCAGGCCCACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-818s21c1
Sequence:CCGGGACTCTGCACCCTGATATACACTCGAGTGTATATCAGGGTGCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-875s21c1
Sequence:CCGGTAGCCTGTCTTGCCATCTTTGCTCGAGCAAAGATGGCAAGACAGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002036.2-1103s21c1
Sequence:CCGGTGGCAGAAGCCCTGGCAATTTCTCGAGAAATTGCCAGGGCTTCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-930s1c1
Sequence:CCGGGCTGAAGAAGGCATTGGGTATCTCGAGATACCCAATGCCTTCTTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-874s1c1
Sequence:CCGGGTAGCCTGTCTTGCCATCTTTCTCGAGAAAGATGGCAAGACAGGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-630s1c1
Sequence:CCGGCCTGGGCTACTGTGTCTGGTACTCGAGTACCAGACACAGTAGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-323s1c1
Sequence:CCGGCTTCCTATGGTGTGAATGATTCTCGAGAATCATTCACACCATAGGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002036.2-438s1c1
Sequence:CCGGCCTCACCAGTGTCCTGGGTATCTCGAGATACCCAGGACACTGGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010045
VALIDATED
DARC MISSION shRNA Bacterial Glycerol Stock
Duffy blood group, atypical chemokine receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-458s1c1
Sequence:CCGGGCTCTGTTGATAGGATGCTATCTCGAGATAGCATCCTATCAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-861s1c1
Sequence:CCGGCCCAGAAGATTCTTGATGCAACTCGAGTTGCATCAAGAATCTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-118s1c1
Sequence:CCGGGTTTGAAGATAACTACTCCTACTCGAGTAGGAGTAGTTATCTTCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010045.1-271s1c1
Sequence:CCGGCGCGATTCTCAGACCTTTCTTCTCGAGAAGAAAGGTCTGAGAATCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010045.1-1004s1c1
Sequence:CCGGGCTTCTCAAATGGATGCCCTTCTCGAGAAGGGCATCCATTTGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010045
VALIDATED
DARC MISSION shRNA shRNA Plasmid DNA
Duffy blood group, atypical chemokine receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-458s1c1
Sequence:CCGGGCTCTGTTGATAGGATGCTATCTCGAGATAGCATCCTATCAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-861s1c1
Sequence:CCGGCCCAGAAGATTCTTGATGCAACTCGAGTTGCATCAAGAATCTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-118s1c1
Sequence:CCGGGTTTGAAGATAACTACTCCTACTCGAGTAGGAGTAGTTATCTTCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010045.1-271s1c1
Sequence:CCGGCGCGATTCTCAGACCTTTCTTCTCGAGAAGAAAGGTCTGAGAATCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010045.1-1004s1c1
Sequence:CCGGGCTTCTCAAATGGATGCCCTTCTCGAGAAGGGCATCCATTTGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010045
VALIDATED
DARC MISSION shRNA Lentiviral Transduction Particles
Duffy blood group, atypical chemokine receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-458s1c1
Sequence:CCGGGCTCTGTTGATAGGATGCTATCTCGAGATAGCATCCTATCAACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-861s1c1
Sequence:CCGGCCCAGAAGATTCTTGATGCAACTCGAGTTGCATCAAGAATCTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010045.1-118s1c1
Sequence:CCGGGTTTGAAGATAACTACTCCTACTCGAGTAGGAGTAGTTATCTTCAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010045.1-271s1c1
Sequence:CCGGCGCGATTCTCAGACCTTTCTTCTCGAGAAGAAAGGTCTGAGAATCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010045.1-1004s1c1
Sequence:CCGGGCTTCTCAAATGGATGCCCTTCTCGAGAAGGGCATCCATTTGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks