EMAIL THIS PAGE TO A FRIEND

DARS2

aspartyl-tRNA synthetase 2, mitochondrial

52 Gene Product Result for
Synonyms: ASPRS LBSL MT-ASPRS RP3-383J4.2
UniProtKB ID: Q6PI48
Gene ID:
Human(55157) Summary: The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. It is a mitochondrial enzyme that specifically aminoacylates aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). [provided by RefSeq, Nov 2009]
Mouse(226539) aspartyl-tRNA synthetase 2 (mitochondrial)
Rat(304919) aspartyl-tRNA synthetase 2 (mitochondrial)
Zebrafish(571144) aspartyl-tRNA synthetase 2, mitochondrial
domestic cat(101094472) aspartyl-tRNA synthetase 2, mitochondrial
cow(538772) aspartyl-tRNA synthetase 2, mitochondrial
Horse(100061003) aspartyl-tRNA synthetase 2, mitochondrial
dog(490337) aspartyl-tRNA synthetase 2, mitochondrial
chicken(424408) aspartyl-tRNA synthetase 2, mitochondrial
sheep(101114203) aspartyl-tRNA synthetase 2, mitochondrial
Domestic Rabbit(100344833) aspartyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101724449) aspartyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100730757) aspartyl-tRNA synthetase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018122 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018122 Rosetta Predictions human pricing
NM_001034143 Rosetta Predictions rat pricing
NM_172644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087000 predicted 1390
2 SASI_Hs02_00351332 predicted 1452
3 SASI_Hs01_00087001 predicted 862
4 SASI_Hs01_00087003 predicted 2050
5 SASI_Hs01_00087004 predicted 1634
6 SASI_Hs01_00087005 predicted 815
7 SASI_Hs01_00087006 predicted 1936
8 SASI_Hs01_00087007 predicted 995
9 SASI_Hs01_00087008 predicted 1255
10 SASI_Hs01_00087009 predicted 1708
11 SASI_Hs01_00087002 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099239 predicted 933
2 SASI_Rn01_00099240 predicted 688
3 SASI_Rn01_00099241 predicted 1836
4 SASI_Rn02_00203994 predicted 1148
5 SASI_Rn01_00099244 predicted 1097
6 SASI_Rn01_00099245 predicted 713
7 SASI_Rn02_00203995 predicted 260
8 SASI_Rn01_00099247 predicted 507
9 SASI_Rn02_00203996 predicted 924
10 SASI_Rn01_00099248 predicted 2040
11 SASI_Rn01_00099242 predicted 1777
12 SASI_Rn01_00099243 predicted 1718
13 SASI_Rn01_00099246 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180768 predicted 2047
2 SASI_Mm01_00180769 predicted 858
3 SASI_Mm01_00180770 predicted 2392
4 SASI_Mm01_00180771 predicted 1707
5 SASI_Mm01_00180772 predicted 1100
6 SASI_Mm01_00180773 predicted 1531
7 SASI_Mm01_00180774 predicted 1504
8 SASI_Mm01_00180775 predicted 2177
9 SASI_Mm01_00180776 predicted 1676
10 SASI_Mm01_00180777 predicted 2019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018122
VALIDATED
DARS2 MISSION shRNA Bacterial Glycerol Stock
aspartyl-tRNA synthetase 2, mitochondrial
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1981s21c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1386s21c1
Sequence:CCGGGCCACCTATGGAACTGATAAACTCGAGTTTATCAGTTCCATAGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-2872s21c1
Sequence:CCGGCACTGAAATGAGAGTCACAAACTCGAGTTTGTGACTCTCATTTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1611s21c1
Sequence:CCGGCCTGTATTCCTTAACGCCAATCTCGAGATTGGCGTTAAGGAATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-944s21c1
Sequence:CCGGGCGTAGTTTCCAAATGCAGTACTCGAGTACTGCATTTGGAAACTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-2944s1c1
Sequence:CCGGCCCTTCCTGCTAATGTGTAAACTCGAGTTTACACATTAGCAGGAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-944s1c1
Sequence:CCGGGCGTAGTTTCCAAATGCAGTACTCGAGTACTGCATTTGGAAACTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-2872s1c1
Sequence:CCGGCACTGAAATGAGAGTCACAAACTCGAGTTTGTGACTCTCATTTCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018122.3-2728s1c1
Sequence:CCGGCCTGTAAACTAGTGAGTTGATCTCGAGATCAACTCACTAGTTTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-1981s1c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-1386s1c1
Sequence:CCGGGCCACCTATGGAACTGATAAACTCGAGTTTATCAGTTCCATAGGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-1611s1c1
Sequence:CCGGCCTGTATTCCTTAACGCCAATCTCGAGATTGGCGTTAAGGAATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-1500s1c1
Sequence:CCGGCATGGAACTGTGAAAGCCATACTCGAGTATGGCTTTCACAGTTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-2057s1c1
Sequence:CCGGGCGTTATATCCTGGCAACCTTCTCGAGAAGGTTGCCAGGATATAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018122
VALIDATED
DARS2 MISSION shRNA shRNA Plasmid DNA
aspartyl-tRNA synthetase 2, mitochondrial
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1981s21c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1386s21c1
Sequence:CCGGGCCACCTATGGAACTGATAAACTCGAGTTTATCAGTTCCATAGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-2872s21c1
Sequence:CCGGCACTGAAATGAGAGTCACAAACTCGAGTTTGTGACTCTCATTTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1611s21c1
Sequence:CCGGCCTGTATTCCTTAACGCCAATCTCGAGATTGGCGTTAAGGAATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-944s21c1
Sequence:CCGGGCGTAGTTTCCAAATGCAGTACTCGAGTACTGCATTTGGAAACTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-2944s1c1
Sequence:CCGGCCCTTCCTGCTAATGTGTAAACTCGAGTTTACACATTAGCAGGAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-944s1c1
Sequence:CCGGGCGTAGTTTCCAAATGCAGTACTCGAGTACTGCATTTGGAAACTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-2872s1c1
Sequence:CCGGCACTGAAATGAGAGTCACAAACTCGAGTTTGTGACTCTCATTTCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018122.3-2728s1c1
Sequence:CCGGCCTGTAAACTAGTGAGTTGATCTCGAGATCAACTCACTAGTTTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-1981s1c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-1386s1c1
Sequence:CCGGGCCACCTATGGAACTGATAAACTCGAGTTTATCAGTTCCATAGGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-1611s1c1
Sequence:CCGGCCTGTATTCCTTAACGCCAATCTCGAGATTGGCGTTAAGGAATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-1500s1c1
Sequence:CCGGCATGGAACTGTGAAAGCCATACTCGAGTATGGCTTTCACAGTTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-2057s1c1
Sequence:CCGGGCGTTATATCCTGGCAACCTTCTCGAGAAGGTTGCCAGGATATAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018122
VALIDATED
DARS2 MISSION shRNA Lentiviral Transduction Particles
aspartyl-tRNA synthetase 2, mitochondrial
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1981s21c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1386s21c1
Sequence:CCGGGCCACCTATGGAACTGATAAACTCGAGTTTATCAGTTCCATAGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-2872s21c1
Sequence:CCGGCACTGAAATGAGAGTCACAAACTCGAGTTTGTGACTCTCATTTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-1611s21c1
Sequence:CCGGCCTGTATTCCTTAACGCCAATCTCGAGATTGGCGTTAAGGAATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_018122.3-944s21c1
Sequence:CCGGGCGTAGTTTCCAAATGCAGTACTCGAGTACTGCATTTGGAAACTACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-2944s1c1
Sequence:CCGGCCCTTCCTGCTAATGTGTAAACTCGAGTTTACACATTAGCAGGAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-944s1c1
Sequence:CCGGGCGTAGTTTCCAAATGCAGTACTCGAGTACTGCATTTGGAAACTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-2872s1c1
Sequence:CCGGCACTGAAATGAGAGTCACAAACTCGAGTTTGTGACTCTCATTTCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018122.3-2728s1c1
Sequence:CCGGCCTGTAAACTAGTGAGTTGATCTCGAGATCAACTCACTAGTTTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-1981s1c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-1386s1c1
Sequence:CCGGGCCACCTATGGAACTGATAAACTCGAGTTTATCAGTTCCATAGGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018122.3-1611s1c1
Sequence:CCGGCCTGTATTCCTTAACGCCAATCTCGAGATTGGCGTTAAGGAATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-1500s1c1
Sequence:CCGGCATGGAACTGTGAAAGCCATACTCGAGTATGGCTTTCACAGTTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018122.3-2057s1c1
Sequence:CCGGGCGTTATATCCTGGCAACCTTCTCGAGAAGGTTGCCAGGATATAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172644
VALIDATED
DARS2 MISSION shRNA Bacterial Glycerol Stock
aspartyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-2103s1c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-998s1c1
Sequence:CCGGCCCTTTGAGATTAAAGACTTTCTCGAGAAAGTCTTTAATCTCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-2413s1c1
Sequence:CCGGGCCTTACCATATCCACGTCTTCTCGAGAAGACGTGGATATGGTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-1323s1c1
Sequence:CCGGGTTACCGAGATGAAGGCTCAACTCGAGTTGAGCCTTCATCTCGGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-1448s1c1
Sequence:CCGGCCTGGTGATAAAGACCCTCTACTCGAGTAGAGGGTCTTTATCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172644
VALIDATED
DARS2 MISSION shRNA shRNA Plasmid DNA
aspartyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-2103s1c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-998s1c1
Sequence:CCGGCCCTTTGAGATTAAAGACTTTCTCGAGAAAGTCTTTAATCTCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-2413s1c1
Sequence:CCGGGCCTTACCATATCCACGTCTTCTCGAGAAGACGTGGATATGGTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-1323s1c1
Sequence:CCGGGTTACCGAGATGAAGGCTCAACTCGAGTTGAGCCTTCATCTCGGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-1448s1c1
Sequence:CCGGCCTGGTGATAAAGACCCTCTACTCGAGTAGAGGGTCTTTATCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172644
VALIDATED
DARS2 MISSION shRNA Lentiviral Transduction Particles
aspartyl-tRNA synthetase 2, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-2103s1c1
Sequence:CCGGGCCAACACTATGACTTGGTTTCTCGAGAAACCAAGTCATAGTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-998s1c1
Sequence:CCGGCCCTTTGAGATTAAAGACTTTCTCGAGAAAGTCTTTAATCTCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-2413s1c1
Sequence:CCGGGCCTTACCATATCCACGTCTTCTCGAGAAGACGTGGATATGGTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-1323s1c1
Sequence:CCGGGTTACCGAGATGAAGGCTCAACTCGAGTTGAGCCTTCATCTCGGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172644.1-1448s1c1
Sequence:CCGGCCTGGTGATAAAGACCCTCTACTCGAGTAGAGGGTCTTTATCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)