EMAIL THIS PAGE TO A FRIEND

DARS

aspartyl-tRNA synthetase

127 Gene Product Result for
Synonyms: HBSL
Gene ID:
Human(1615) Summary: Aspartyl-tRNA synthetase (DARS) is part of a multienzyme complex of aminoacyl-tRNA synthetases. Aspartyl-tRNA synthetase charges its cognate tRNA with aspartate during protein biosynthesis. [provided by RefSeq, Jul 2008]
Mouse(226414) aspartyl-tRNA synthetase
Rat(116483) aspartyl-tRNA synthetase
Zebrafish(324025) aspartyl-tRNA synthetase
cow(510162) aspartyl-tRNA synthetase
Horse(100050898) aspartyl-tRNA synthetase
domestic cat(101092954) aspartyl-tRNA synthetase
dog(476132) aspartyl-tRNA synthetase
chicken(424296) aspartyl-tRNA synthetase
domestic guinea pig(100731616) aspartyl-tRNA synthetase
naked mole-rat(101698896) aspartyl-tRNA synthetase
sheep(100302097) aspartyl-tRNA synthetase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001349 Rosetta Predictions human pricing
NM_053799 Rosetta Predictions rat pricing
NM_145507 Rosetta Predictions mouse pricing
NM_177445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132424 predicted 732
2 SASI_Hs01_00132425 predicted 803
3 SASI_Hs02_00331678 predicted 1037
4 SASI_Hs01_00132426 predicted 1369
5 SASI_Hs01_00132427 predicted 728
6 SASI_Hs01_00132428 predicted 747
7 SASI_Hs01_00132429 predicted 264
8 SASI_Hs01_00132430 predicted 247
9 SASI_Hs01_00132432 predicted 1223
10 SASI_Hs01_00132433 predicted 807
11 SASI_Hs01_00132431 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042602 predicted 827
2 SASI_Rn01_00042603 predicted 1040
3 SASI_Rn01_00042604 predicted 1181
4 SASI_Rn01_00042605 predicted 617
5 SASI_Rn02_00266610 predicted 1023
6 SASI_Rn01_00042606 predicted 241
7 SASI_Rn01_00042608 predicted 614
8 SASI_Rn02_00266611 predicted 1191
9 SASI_Rn01_00042609 predicted 825
10 SASI_Rn01_00042610 predicted 521
11 SASI_Rn01_00042607 predicted 265
12 SASI_Rn01_00042611 predicted 1347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102387 predicted 1385
2 SASI_Mm01_00102388 predicted 1422
3 SASI_Mm01_00102389 predicted 1414
4 SASI_Mm01_00102390 predicted 1468
5 SASI_Mm01_00102391 predicted 1506
6 SASI_Mm01_00102392 predicted 1538
7 SASI_Mm01_00102393 predicted 1385
8 SASI_Mm01_00102394 predicted 1411
9 SASI_Mm01_00102395 predicted 1469
10 SASI_Mm01_00102396 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111590 predicted 1415
2 SASI_Mm01_00111591 predicted 1450
3 SASI_Mm01_00111592 predicted 1435
4 SASI_Mm01_00111593 predicted 1498
5 SASI_Mm01_00111594 predicted 1534
6 SASI_Mm01_00111595 predicted 1563
7 SASI_Mm01_00111596 predicted 1407
8 SASI_Mm01_00111597 predicted 1437
9 SASI_Mm01_00111598 predicted 1496
10 SASI_Mm01_00111599 predicted 1417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001349
VALIDATED
DARS MISSION shRNA Bacterial Glycerol Stock
aspartyl-tRNA synthetase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001349.2-1081s1c1
Sequence:CCGGCCACGAAGTTATGGAAGAAATCTCGAGATTTCTTCCATAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001349.2-1207s1c1
Sequence:CCGGGCCAACTCTAAGACTAGAATACTCGAGTATTCTAGTCTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001349.2-473s1c1
Sequence:CCGGGCAAGCAAGCAGATGGTTAAACTCGAGTTTAACCATCTGCTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1884s21c1
Sequence:CCGGTTCAGTATAGGTTCGTTTAAACTCGAGTTTAAACGAACCTATACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-473s21c1
Sequence:CCGGGCAAGCAAGCAGATGGTTAAACTCGAGTTTAACCATCTGCTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1081s21c1
Sequence:CCGGCCACGAAGTTATGGAAGAAATCTCGAGATTTCTTCCATAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001349.2-1207s21c1
Sequence:CCGGGCCAACTCTAAGACTAGAATACTCGAGTATTCTAGTCTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1672s21c1
Sequence:CCGGCAAACGACTCACTCCTTAAATCTCGAGATTTAAGGAGTGAGTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001349
VALIDATED
DARS MISSION shRNA shRNA Plasmid DNA
aspartyl-tRNA synthetase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001349.2-1081s1c1
Sequence:CCGGCCACGAAGTTATGGAAGAAATCTCGAGATTTCTTCCATAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001349.2-1207s1c1
Sequence:CCGGGCCAACTCTAAGACTAGAATACTCGAGTATTCTAGTCTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001349.2-473s1c1
Sequence:CCGGGCAAGCAAGCAGATGGTTAAACTCGAGTTTAACCATCTGCTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1884s21c1
Sequence:CCGGTTCAGTATAGGTTCGTTTAAACTCGAGTTTAAACGAACCTATACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-473s21c1
Sequence:CCGGGCAAGCAAGCAGATGGTTAAACTCGAGTTTAACCATCTGCTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1081s21c1
Sequence:CCGGCCACGAAGTTATGGAAGAAATCTCGAGATTTCTTCCATAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001349.2-1207s21c1
Sequence:CCGGGCCAACTCTAAGACTAGAATACTCGAGTATTCTAGTCTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1672s21c1
Sequence:CCGGCAAACGACTCACTCCTTAAATCTCGAGATTTAAGGAGTGAGTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001349
VALIDATED
DARS MISSION shRNA Lentiviral Transduction Particles
aspartyl-tRNA synthetase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001349.2-1081s1c1
Sequence:CCGGCCACGAAGTTATGGAAGAAATCTCGAGATTTCTTCCATAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_001349.2-1207s1c1
Sequence:CCGGGCCAACTCTAAGACTAGAATACTCGAGTATTCTAGTCTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001349.2-473s1c1
Sequence:CCGGGCAAGCAAGCAGATGGTTAAACTCGAGTTTAACCATCTGCTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296991    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1884s21c1
Sequence:CCGGTTCAGTATAGGTTCGTTTAAACTCGAGTTTAAACGAACCTATACTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-473s21c1
Sequence:CCGGGCAAGCAAGCAGATGGTTAAACTCGAGTTTAACCATCTGCTTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1081s21c1
Sequence:CCGGCCACGAAGTTATGGAAGAAATCTCGAGATTTCTTCCATAACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001349.2-1207s21c1
Sequence:CCGGGCCAACTCTAAGACTAGAATACTCGAGTATTCTAGTCTTAGAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_001349.2-1672s21c1
Sequence:CCGGCAAACGACTCACTCCTTAAATCTCGAGATTTAAGGAGTGAGTCGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177445
VALIDATED
DARS MISSION shRNA Bacterial Glycerol Stock
aspartyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-1194s1c1
Sequence:CCGGGCTGGAGTTGAAATGGACGATCTCGAGATCGTCCATTTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177445.2-1455s1c1
Sequence:CCGGCATGGAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-261s1c1
Sequence:CCGGCGAGTTAAGGACCTGACAGTTCTCGAGAACTGTCAGGTCCTTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177445.2-1656s1c1
Sequence:CCGGCCTGCTATTGATTAGGTTATACTCGAGTATAACCTAATCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-958s1c1
Sequence:CCGGCCCATAGACATCTGACTGAATCTCGAGATTCAGTCAGATGTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1271s21c1
Sequence:CCGGGCTGGAGTTGAAATGGACGATCTCGAGATCGTCCATTTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177445.5-1733s21c1
Sequence:CCGGCCTGCTATTGATTAGGTTATACTCGAGTATAACCTAATCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1532s21c1
Sequence:CCGGCATGGAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-338s21c1
Sequence:CCGGCGAGTTAAGGACCTGACAGTTCTCGAGAACTGTCAGGTCCTTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1035s21c1
Sequence:CCGGCCCATAGACATCTGACTGAATCTCGAGATTCAGTCAGATGTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177445
VALIDATED
DARS MISSION shRNA shRNA Plasmid DNA
aspartyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-1194s1c1
Sequence:CCGGGCTGGAGTTGAAATGGACGATCTCGAGATCGTCCATTTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177445.2-1455s1c1
Sequence:CCGGCATGGAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-261s1c1
Sequence:CCGGCGAGTTAAGGACCTGACAGTTCTCGAGAACTGTCAGGTCCTTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177445.2-1656s1c1
Sequence:CCGGCCTGCTATTGATTAGGTTATACTCGAGTATAACCTAATCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-958s1c1
Sequence:CCGGCCCATAGACATCTGACTGAATCTCGAGATTCAGTCAGATGTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1271s21c1
Sequence:CCGGGCTGGAGTTGAAATGGACGATCTCGAGATCGTCCATTTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177445.5-1733s21c1
Sequence:CCGGCCTGCTATTGATTAGGTTATACTCGAGTATAACCTAATCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1532s21c1
Sequence:CCGGCATGGAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-338s21c1
Sequence:CCGGCGAGTTAAGGACCTGACAGTTCTCGAGAACTGTCAGGTCCTTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1035s21c1
Sequence:CCGGCCCATAGACATCTGACTGAATCTCGAGATTCAGTCAGATGTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177445
VALIDATED
DARS MISSION shRNA Lentiviral Transduction Particles
aspartyl-tRNA synthetase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-1194s1c1
Sequence:CCGGGCTGGAGTTGAAATGGACGATCTCGAGATCGTCCATTTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177445.2-1455s1c1
Sequence:CCGGCATGGAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-261s1c1
Sequence:CCGGCGAGTTAAGGACCTGACAGTTCTCGAGAACTGTCAGGTCCTTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177445.2-1656s1c1
Sequence:CCGGCCTGCTATTGATTAGGTTATACTCGAGTATAACCTAATCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177445.2-958s1c1
Sequence:CCGGCCCATAGACATCTGACTGAATCTCGAGATTCAGTCAGATGTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1271s21c1
Sequence:CCGGGCTGGAGTTGAAATGGACGATCTCGAGATCGTCCATTTCAACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177445.5-1733s21c1
Sequence:CCGGCCTGCTATTGATTAGGTTATACTCGAGTATAACCTAATCAATAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1532s21c1
Sequence:CCGGCATGGAATTGATTTGGAGAAACTCGAGTTTCTCCAAATCAATTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-338s21c1
Sequence:CCGGCGAGTTAAGGACCTGACAGTTCTCGAGAACTGTCAGGTCCTTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177445.5-1035s21c1
Sequence:CCGGCCCATAGACATCTGACTGAATCTCGAGATTCAGTCAGATGTCTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks