EMAIL THIS PAGE TO A FRIEND

DAW1

dynein assembly factor with WDR repeat domains 1

68 Gene Product Result for
Synonyms: ODA16 WDR69
UniProtKB ID: Q8N136, Q6ZRY1, Q8N776
Gene ID:
Mouse(71227) dynein assembly factor with WDR repeat domains 1
Rat(363267) dynein assembly factor with WDR repeat domains 1
Zebrafish(556760) dynein assembly factor with WDR repeat domains 1
cow(530118) WD repeat domain 69
domestic guinea pig(100731037) dynein assembly factor with WDR repeat domains 1
naked mole-rat(101716949) dynein assembly factor with WDR repeat domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178821 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019511 MISSION® esiRNA esiRNA targeting human WDR69 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178821 Rosetta Predictions human pricing
NM_001025025 Rosetta Predictions rat pricing
NM_027725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056605 predicted 685
2 SASI_Hs01_00056606 predicted 358
3 SASI_Hs01_00056607 predicted 234
4 SASI_Hs01_00056608 predicted 881
5 SASI_Hs01_00056609 predicted 481
6 SASI_Hs01_00056611 predicted 1292
7 SASI_Hs01_00056612 predicted 995
8 SASI_Hs01_00056613 predicted 1357
9 SASI_Hs01_00056614 predicted 392
10 SASI_Hs02_00369866 predicted 1256
11 SASI_Hs01_00056610 predicted 407
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077970 predicted 1263
2 SASI_Rn02_00202937 predicted 1344
3 SASI_Rn01_00077972 predicted 798
4 SASI_Rn01_00077973 predicted 1370
5 SASI_Rn01_00077974 predicted 266
6 SASI_Rn01_00077976 predicted 964
7 SASI_Rn02_00202938 predicted 739
8 SASI_Rn01_00077977 predicted 906
9 SASI_Rn01_00077978 predicted 1205
10 SASI_Rn01_00077979 predicted 204
11 SASI_Rn01_00077971 predicted 1032
12 SASI_Rn01_00077975 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042186 predicted 1038
2 SASI_Mm01_00042187 predicted 270
3 SASI_Mm01_00042188 predicted 683
4 SASI_Mm01_00042189 predicted 525
5 SASI_Mm01_00042190 predicted 528
6 SASI_Mm02_00332654 predicted 352
7 SASI_Mm01_00042191 predicted 725
8 SASI_Mm01_00042192 predicted 901
9 SASI_Mm01_00042193 predicted 901
10 SASI_Mm01_00042194 predicted 285
11 SASI_Mm01_00042185 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027725
DAW1 MISSION shRNA Bacterial Glycerol Stock
dynein assembly factor with WDR repeat domains 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027725.1-153s1c1
Sequence:CCGGGCTGATGTCAACACCCTAGTACTCGAGTACTAGGGTGTTGACATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-302s1c1
Sequence:CCGGCAGAGCACACATATTGCCATTCTCGAGAATGGCAATATGTGTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-722s1c1
Sequence:CCGGCACAAGAAAGTGTGTAACCAACTCGAGTTGGTTACACACTTTCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-75s1c1
Sequence:CCGGCCAGGAATTATGCTGGAATATCTCGAGATATTCCAGCATAATTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027725.1-814s1c1
Sequence:CCGGGCTCTGATAAGACAGCCAGAACTCGAGTTCTGGCTGTCTTATCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027725.1-1173s1c1
Sequence:CCGGGCAGGCATAATATGTGTTAAACTCGAGTTTAACACATATTATGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-700s1c1
Sequence:CCGGCGGCAAGAGTTTACAATGCAACTCGAGTTGCATTGTAAACTCTTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027725.2-1145s1c1
Sequence:CCGGGACATTATCTAAAGGTTATTGCTCGAGCAATAACCTTTAGATAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027725
DAW1 MISSION shRNA shRNA Plasmid DNA
dynein assembly factor with WDR repeat domains 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027725.1-153s1c1
Sequence:CCGGGCTGATGTCAACACCCTAGTACTCGAGTACTAGGGTGTTGACATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-302s1c1
Sequence:CCGGCAGAGCACACATATTGCCATTCTCGAGAATGGCAATATGTGTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-722s1c1
Sequence:CCGGCACAAGAAAGTGTGTAACCAACTCGAGTTGGTTACACACTTTCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-75s1c1
Sequence:CCGGCCAGGAATTATGCTGGAATATCTCGAGATATTCCAGCATAATTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027725.1-814s1c1
Sequence:CCGGGCTCTGATAAGACAGCCAGAACTCGAGTTCTGGCTGTCTTATCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027725.1-1173s1c1
Sequence:CCGGGCAGGCATAATATGTGTTAAACTCGAGTTTAACACATATTATGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-700s1c1
Sequence:CCGGCGGCAAGAGTTTACAATGCAACTCGAGTTGCATTGTAAACTCTTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027725.2-1145s1c1
Sequence:CCGGGACATTATCTAAAGGTTATTGCTCGAGCAATAACCTTTAGATAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027725
DAW1 MISSION shRNA Lentiviral Transduction Particles
dynein assembly factor with WDR repeat domains 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027725.1-153s1c1
Sequence:CCGGGCTGATGTCAACACCCTAGTACTCGAGTACTAGGGTGTTGACATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-302s1c1
Sequence:CCGGCAGAGCACACATATTGCCATTCTCGAGAATGGCAATATGTGTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-722s1c1
Sequence:CCGGCACAAGAAAGTGTGTAACCAACTCGAGTTGGTTACACACTTTCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-75s1c1
Sequence:CCGGCCAGGAATTATGCTGGAATATCTCGAGATATTCCAGCATAATTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027725.1-814s1c1
Sequence:CCGGGCTCTGATAAGACAGCCAGAACTCGAGTTCTGGCTGTCTTATCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027725.1-1173s1c1
Sequence:CCGGGCAGGCATAATATGTGTTAAACTCGAGTTTAACACATATTATGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027725.1-700s1c1
Sequence:CCGGCGGCAAGAGTTTACAATGCAACTCGAGTTGCATTGTAAACTCTTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215749    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_027725.2-1145s1c1
Sequence:CCGGGACATTATCTAAAGGTTATTGCTCGAGCAATAACCTTTAGATAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178821
DAW1 MISSION shRNA Bacterial Glycerol Stock
dynein assembly factor with WDR repeat domains 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178821.1-1433s1c1
Sequence:CCGGGCAAGTCAACTATTTCTACAACTCGAGTTGTAGAAATAGTTGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-116s1c1
Sequence:CCGGCCAGGAATTATGTTGGAATATCTCGAGATATTCCAACATAATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-657s1c1
Sequence:CCGGCGACTGGAAGTATGGACACAACTCGAGTTGTGTCCATACTTCCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-1293s1c1
Sequence:CCGGGCAGCAAGGATAATACCTGTACTCGAGTACAGGTATTATCCTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-1005s1c1
Sequence:CCGGGCTGCTTTGATTACACTGGAACTCGAGTTCCAGTGTAATCAAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178821.1-705s21c1
Sequence:CCGGGCGAGGAAGTTTACACCTTAACTCGAGTTAAGGTGTAAACTTCCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178821.1-1494s21c1
Sequence:CCGGAGTTATGCCACTCCAATATTACTCGAGTAATATTGGAGTGGCATAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178821.1-1465s21c1
Sequence:CCGGTTCACAGATATGACCATTAAACTCGAGTTTAATGGTCATATCTGTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178821
DAW1 MISSION shRNA shRNA Plasmid DNA
dynein assembly factor with WDR repeat domains 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178821.1-1433s1c1
Sequence:CCGGGCAAGTCAACTATTTCTACAACTCGAGTTGTAGAAATAGTTGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-116s1c1
Sequence:CCGGCCAGGAATTATGTTGGAATATCTCGAGATATTCCAACATAATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-657s1c1
Sequence:CCGGCGACTGGAAGTATGGACACAACTCGAGTTGTGTCCATACTTCCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-1293s1c1
Sequence:CCGGGCAGCAAGGATAATACCTGTACTCGAGTACAGGTATTATCCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-1005s1c1
Sequence:CCGGGCTGCTTTGATTACACTGGAACTCGAGTTCCAGTGTAATCAAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178821.1-705s21c1
Sequence:CCGGGCGAGGAAGTTTACACCTTAACTCGAGTTAAGGTGTAAACTTCCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178821.1-1494s21c1
Sequence:CCGGAGTTATGCCACTCCAATATTACTCGAGTAATATTGGAGTGGCATAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178821.1-1465s21c1
Sequence:CCGGTTCACAGATATGACCATTAAACTCGAGTTTAATGGTCATATCTGTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178821
DAW1 MISSION shRNA Lentiviral Transduction Particles
dynein assembly factor with WDR repeat domains 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178821.1-1433s1c1
Sequence:CCGGGCAAGTCAACTATTTCTACAACTCGAGTTGTAGAAATAGTTGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-116s1c1
Sequence:CCGGCCAGGAATTATGTTGGAATATCTCGAGATATTCCAACATAATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-657s1c1
Sequence:CCGGCGACTGGAAGTATGGACACAACTCGAGTTGTGTCCATACTTCCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-1293s1c1
Sequence:CCGGGCAGCAAGGATAATACCTGTACTCGAGTACAGGTATTATCCTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178821.1-1005s1c1
Sequence:CCGGGCTGCTTTGATTACACTGGAACTCGAGTTCCAGTGTAATCAAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178821.1-705s21c1
Sequence:CCGGGCGAGGAAGTTTACACCTTAACTCGAGTTAAGGTGTAAACTTCCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178821.1-1494s21c1
Sequence:CCGGAGTTATGCCACTCCAATATTACTCGAGTAATATTGGAGTGGCATAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178821.1-1465s21c1
Sequence:CCGGTTCACAGATATGACCATTAAACTCGAGTTTAATGGTCATATCTGTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)