EMAIL THIS PAGE TO A FRIEND

DAXX

death-domain associated protein

71 Gene Product Result for
Synonyms: BING2 DAP6 EAP1
Gene ID:
Human(1616) Summary: This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
Mouse(13163) Fas death domain-associated protein
Rat(140926) death-domain associated protein
naked mole-rat(101717412) death-domain associated protein
domestic guinea pig(100730008) death-domain associated protein
sheep(100505403) death-domain associated protein
Zebrafish(561006) death-associated protein 6
dog(474873) death-domain associated protein
cow(504336) death-domain associated protein
domestic cat(101089265) death-domain associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D7810 Anti-Daxx antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution monkey, mouse, human
microarray, western blot pricing
SAB3500205 Anti-Daxx antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, western blot pricing
HPA008736 Anti-DAXX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410283 Anti-DAXX antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA065779 Anti-DAXX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4500623 Anti-DAXX, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB4503864 Anti-phospho-Daxx (pSer668) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
WH0001616M3 Monoclonal Anti-DAXX antibody produced in mouse clone 4C2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300315 Monoclonal Anti-DAXX antibody produced in mouse clone 7A11, ascites fluid human
ELISA, flow cytometry, immunofluorescence, western blot pricing
AMAB91191 Monoclonal Anti-DAXX antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3580, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
PLA0183 Rabbit anti-DAXX Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, human, chimpanzee
proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069231 MISSION® esiRNA esiRNA targeting mouse Daxx (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001350 Rosetta Predictions human pricing
NM_080891 Rosetta Predictions rat pricing
NM_007829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138404 predicted 259
2 SASI_Hs01_00138405 predicted 951
3 SASI_Hs01_00138406 predicted 951
4 SASI_Hs01_00138407 predicted 281
5 SASI_Hs01_00138408 predicted 2039
6 SASI_Hs01_00138409 predicted 560
7 SASI_Hs01_00138410 predicted 2049
8 SASI_Hs02_00331679 predicted 807
9 SASI_Hs01_00138411 predicted 922
10 SASI_Hs01_00138412 predicted 750
11 SASI_Hs01_00138413 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080891 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056684 predicted 576
2 SASI_Rn01_00056685 predicted 1049
3 SASI_Rn01_00056686 predicted 309
4 SASI_Rn02_00267342 predicted 592
5 SASI_Rn01_00056687 predicted 1900
6 SASI_Rn01_00056688 predicted 756
7 SASI_Rn01_00056689 predicted 1791
8 SASI_Rn01_00056690 predicted 1946
9 SASI_Rn01_00056691 predicted 744
10 SASI_Rn01_00056692 predicted 852
11 SASI_Rn01_00056683 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200481 predicted 277
2 SASI_Mm01_00200482 predicted 563
3 SASI_Mm01_00200483 predicted 490
4 SASI_Mm01_00200486 predicted 447
5 SASI_Mm01_00200487 predicted 1195
6 SASI_Mm01_00200488 predicted 883
7 SASI_Mm02_00312563 predicted 495
8 SASI_Mm02_00312564 predicted 441
9 SASI_Mm02_00312565 predicted 899
10 SASI_Mm01_00200480 predicted 301
11 SASI_Mm01_00200484 predicted 289
12 SASI_Mm01_00200485 predicted 452
13 SASI_Mm01_00200489 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007829
VALIDATED
DAXX MISSION shRNA Bacterial Glycerol Stock
death-domain associated protein
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-2255s21c1
Sequence:CCGGAGTCTCTCCGGCAGTGTATTTCTCGAGAAATACACTGCCGGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-1943s21c1
Sequence:CCGGTTACCTCTACATCTGTCAATGCTCGAGCATTGACAGATGTAGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-305s21c1
Sequence:GTACCGGAGTGCTACAAGTTGGATAATGCTCGAGCATTATCCAACTTGTAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-2048s21c1
Sequence:CCGGTGTTAGGAAACAGCTATATAACTCGAGTTATATAGCTGTTTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-1149s21c1
Sequence:CCGGTCACCTCACAGATGACTATAGCTCGAGCTATAGTCATCTGTGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-941s21c1
Sequence:CCGGGGCGCATTGAACGGCTCATTACTCGAGTAATGAGCCGTTCAATGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-783s21c1
Sequence:CCGGTGACCCAGACTCCTCGTATTTCTCGAGAAATACGAGGAGTCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-1122s21c1
Sequence:CCGGCCTGGATCTCATCTACAACTTCTCGAGAAGTTGTAGATGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-2142s21c1
Sequence:CCGGTGTGGCTTCTGTCGCTGATTCCTCGAGGAATCAGCGACAGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-720s1c1
Sequence:CCGGCCGCTTGAAGAGGAAGTTGATCTCGAGATCAACTTCCTCTTCAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007829.1-1029s1c1
Sequence:CCGGCCTGGATCTCATCTACAACTTCTCGAGAAGTTGTAGATGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-399s1c1
Sequence:CCGGGCCCGCTAAGATCTATGTGTACTCGAGTACACATAGATCTTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007829.1-849s1c1
Sequence:CCGGGCGCATTGAACGGCTCATTAACTCGAGTTAATGAGCCGTTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-2209s1c1
Sequence:CCGGCCGGAGGAGATCATCGTGCTTCTCGAGAAGCACGATGATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007829
VALIDATED
DAXX MISSION shRNA shRNA Plasmid DNA
death-domain associated protein
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-2255s21c1
Sequence:CCGGAGTCTCTCCGGCAGTGTATTTCTCGAGAAATACACTGCCGGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-1943s21c1
Sequence:CCGGTTACCTCTACATCTGTCAATGCTCGAGCATTGACAGATGTAGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-305s21c1
Sequence:GTACCGGAGTGCTACAAGTTGGATAATGCTCGAGCATTATCCAACTTGTAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-2048s21c1
Sequence:CCGGTGTTAGGAAACAGCTATATAACTCGAGTTATATAGCTGTTTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-1149s21c1
Sequence:CCGGTCACCTCACAGATGACTATAGCTCGAGCTATAGTCATCTGTGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-941s21c1
Sequence:CCGGGGCGCATTGAACGGCTCATTACTCGAGTAATGAGCCGTTCAATGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-783s21c1
Sequence:CCGGTGACCCAGACTCCTCGTATTTCTCGAGAAATACGAGGAGTCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-1122s21c1
Sequence:CCGGCCTGGATCTCATCTACAACTTCTCGAGAAGTTGTAGATGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-2142s21c1
Sequence:CCGGTGTGGCTTCTGTCGCTGATTCCTCGAGGAATCAGCGACAGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-720s1c1
Sequence:CCGGCCGCTTGAAGAGGAAGTTGATCTCGAGATCAACTTCCTCTTCAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007829.1-1029s1c1
Sequence:CCGGCCTGGATCTCATCTACAACTTCTCGAGAAGTTGTAGATGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-399s1c1
Sequence:CCGGGCCCGCTAAGATCTATGTGTACTCGAGTACACATAGATCTTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007829.1-849s1c1
Sequence:CCGGGCGCATTGAACGGCTCATTAACTCGAGTTAATGAGCCGTTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-2209s1c1
Sequence:CCGGCCGGAGGAGATCATCGTGCTTCTCGAGAAGCACGATGATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007829
VALIDATED
DAXX MISSION shRNA Lentiviral Transduction Particles
death-domain associated protein
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-2255s21c1
Sequence:CCGGAGTCTCTCCGGCAGTGTATTTCTCGAGAAATACACTGCCGGAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-1943s21c1
Sequence:CCGGTTACCTCTACATCTGTCAATGCTCGAGCATTGACAGATGTAGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-305s21c1
Sequence:GTACCGGAGTGCTACAAGTTGGATAATGCTCGAGCATTATCCAACTTGTAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-2048s21c1
Sequence:CCGGTGTTAGGAAACAGCTATATAACTCGAGTTATATAGCTGTTTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-1149s21c1
Sequence:CCGGTCACCTCACAGATGACTATAGCTCGAGCTATAGTCATCTGTGAGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-941s21c1
Sequence:CCGGGGCGCATTGAACGGCTCATTACTCGAGTAATGAGCCGTTCAATGCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007829.3-783s21c1
Sequence:CCGGTGACCCAGACTCCTCGTATTTCTCGAGAAATACGAGGAGTCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-1122s21c1
Sequence:CCGGCCTGGATCTCATCTACAACTTCTCGAGAAGTTGTAGATGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007829.3-2142s21c1
Sequence:CCGGTGTGGCTTCTGTCGCTGATTCCTCGAGGAATCAGCGACAGAAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-720s1c1
Sequence:CCGGCCGCTTGAAGAGGAAGTTGATCTCGAGATCAACTTCCTCTTCAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007829.1-1029s1c1
Sequence:CCGGCCTGGATCTCATCTACAACTTCTCGAGAAGTTGTAGATGAGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-399s1c1
Sequence:CCGGGCCCGCTAAGATCTATGTGTACTCGAGTACACATAGATCTTAGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007829.1-849s1c1
Sequence:CCGGGCGCATTGAACGGCTCATTAACTCGAGTTAATGAGCCGTTCAATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007829.1-2209s1c1
Sequence:CCGGCCGGAGGAGATCATCGTGCTTCTCGAGAAGCACGATGATCTCCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001350
VALIDATED
DAXX MISSION shRNA Bacterial Glycerol Stock
death-domain associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-2502s21c1
Sequence:CCGGGAAGGGATGGACTAAGCTAATCTCGAGATTAGCTTAGTCCATCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-1789s21c1
Sequence:CCGGTCACCATCGTTACTGTCAGAACTCGAGTTCTGACAGTAACGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-1218s21c1
Sequence:CCGGCCACCTCACAGATGACTATAGCTCGAGCTATAGTCATCTGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-2377s21c1
Sequence:CCGGGCCACACAATGCGATCCAGAACTCGAGTTCTGGATCGCATTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001350.4-1041s21c1
Sequence:CCGGGCCTGATACCTTCCCTGACTACTCGAGTAGTCAGGGAAGGTATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-1697s1c1
Sequence:CCGGTCACCATCGTTACTGTCAGAACTCGAGTTCTGACAGTAACGATGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-949s1c1
Sequence:CCGGGCCTGATACCTTCCCTGACTACTCGAGTAGTCAGGGAAGGTATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-2410s1c1
Sequence:CCGGGAAGGGATGGACTAAGCTAATCTCGAGATTAGCTTAGTCCATCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001350.x-862s1c1
Sequence:CCGGCCGTGTCATAGAGCAGCGCATCTCGAGATGCGCTGCTCTATGACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-2285s1c1
Sequence:CCGGGCCACACAATGCGATCCAGAACTCGAGTTCTGGATCGCATTGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001350
VALIDATED
DAXX MISSION shRNA shRNA Plasmid DNA
death-domain associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-2502s21c1
Sequence:CCGGGAAGGGATGGACTAAGCTAATCTCGAGATTAGCTTAGTCCATCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-1789s21c1
Sequence:CCGGTCACCATCGTTACTGTCAGAACTCGAGTTCTGACAGTAACGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-1218s21c1
Sequence:CCGGCCACCTCACAGATGACTATAGCTCGAGCTATAGTCATCTGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-2377s21c1
Sequence:CCGGGCCACACAATGCGATCCAGAACTCGAGTTCTGGATCGCATTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001350.4-1041s21c1
Sequence:CCGGGCCTGATACCTTCCCTGACTACTCGAGTAGTCAGGGAAGGTATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-1697s1c1
Sequence:CCGGTCACCATCGTTACTGTCAGAACTCGAGTTCTGACAGTAACGATGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-949s1c1
Sequence:CCGGGCCTGATACCTTCCCTGACTACTCGAGTAGTCAGGGAAGGTATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-2410s1c1
Sequence:CCGGGAAGGGATGGACTAAGCTAATCTCGAGATTAGCTTAGTCCATCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001350.x-862s1c1
Sequence:CCGGCCGTGTCATAGAGCAGCGCATCTCGAGATGCGCTGCTCTATGACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-2285s1c1
Sequence:CCGGGCCACACAATGCGATCCAGAACTCGAGTTCTGGATCGCATTGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001350
VALIDATED
DAXX MISSION shRNA Lentiviral Transduction Particles
death-domain associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-2502s21c1
Sequence:CCGGGAAGGGATGGACTAAGCTAATCTCGAGATTAGCTTAGTCCATCCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-1789s21c1
Sequence:CCGGTCACCATCGTTACTGTCAGAACTCGAGTTCTGACAGTAACGATGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-1218s21c1
Sequence:CCGGCCACCTCACAGATGACTATAGCTCGAGCTATAGTCATCTGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001350.4-2377s21c1
Sequence:CCGGGCCACACAATGCGATCCAGAACTCGAGTTCTGGATCGCATTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001350.4-1041s21c1
Sequence:CCGGGCCTGATACCTTCCCTGACTACTCGAGTAGTCAGGGAAGGTATCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-1697s1c1
Sequence:CCGGTCACCATCGTTACTGTCAGAACTCGAGTTCTGACAGTAACGATGGTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-949s1c1
Sequence:CCGGGCCTGATACCTTCCCTGACTACTCGAGTAGTCAGGGAAGGTATCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-2410s1c1
Sequence:CCGGGAAGGGATGGACTAAGCTAATCTCGAGATTAGCTTAGTCCATCCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001350.x-862s1c1
Sequence:CCGGCCGTGTCATAGAGCAGCGCATCTCGAGATGCGCTGCTCTATGACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001350.x-2285s1c1
Sequence:CCGGGCCACACAATGCGATCCAGAACTCGAGTTCTGGATCGCATTGTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks