EMAIL THIS PAGE TO A FRIEND

DAZ2

deleted in azoospermia 2

83 Gene Product Result for
Synonyms: pDP1678
Species: Human DAZ2(57055)
UniProtKB ID: Q13117, Q2KHN6, Q96P41, Q9NR91
Gene ID:
Human(57055) Summary: This gene is a member of the DAZ gene family and is a candidate for the human Y-chromosomal azoospermia factor (AZF). Its expression is restricted to premeiotic germ cells, particularly in spermatogonia. It encodes an RNA-binding protein that is important for spermatogenesis. Four copies of this gene are found on chromosome Y within palindromic duplications; one pair of genes is part of the P2 palindrome and the second pair is part of the P1 palindrome. Each gene contains a 2.4 kb repeat including a 72-bp exon, called the DAZ repeat; the number of DAZ repeats is variable and there are several variations in the sequence of the DAZ repeat. Each copy of the gene also contains a 10.8 kb region that may be amplified; this region includes five exons that encode an RNA recognition motif (RRM) domain. This gene contains one copy of the 10.8 kb repeat. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020363 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020363 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020363 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005785 Rosetta Predictions human pricing
NM_001005786 Rosetta Predictions human pricing
NM_020363 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028792 predicted 1940
2 SASI_Hs01_00028793 predicted 1954
3 SASI_Hs01_00028794 predicted 1929
4 SASI_Hs01_00028795 predicted 431
5 SASI_Hs01_00028796 predicted 1967
6 SASI_Hs01_00028797 predicted 1889
7 SASI_Hs01_00028798 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165044 predicted 1371
2 SASI_Hs01_00165045 predicted 1386
3 SASI_Hs01_00165046 predicted 1364
4 SASI_Hs01_00165047 predicted 377
5 SASI_Hs01_00165048 predicted 1404
6 SASI_Hs01_00165049 predicted 1323
7 SASI_Hs01_00165050 predicted 1296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020363 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00353307 predicted 1942
2 SASI_Hs02_00353308 predicted 1951
3 SASI_Hs02_00353309 predicted 1930
4 SASI_Hs02_00353310 predicted 363
5 SASI_Hs02_00353311 predicted 1967
6 SASI_Hs02_00353312 predicted 1886
7 SASI_Hs02_00353313 predicted 1867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020363
DAZ2 MISSION shRNA Bacterial Glycerol Stock
deleted in azoospermia 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-1176s21c1
Sequence:CCGGAGTTGCCTGTATACAATTATCCTCGAGGATAATTGTATACAGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-1127s21c1
Sequence:CCGGGCATTTCCTGCTTATCCAAATCTCGAGATTTGGATAAGCAGGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-682s21c1
Sequence:CCGGTCAGCACGTTCAGGCTTATTCCTCGAGGAATAAGCCTGAACGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-572s1c1
Sequence:CCGGCCACGTCCTTTGGTAGTTAATCTCGAGATTAACTACCAAAGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1712s1c1
Sequence:CCGGGCTTATCCAAATTCAGCAGTTCTCGAGAACTGCTGAATTTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1822s1c1
Sequence:CCGGCGAAGCATACAAATGGTGGTACTCGAGTACCACCATTTGTATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1064s1c1
Sequence:CCGGGCTTATCCAAATTCACCATTTCTCGAGAAATGGTGAATTTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-432s1c1
Sequence:CCGGCCAAAGGCTATGGATTTGTTTCTCGAGAAACAAATCCATAGCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020363
DAZ2 MISSION shRNA shRNA Plasmid DNA
deleted in azoospermia 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-1176s21c1
Sequence:CCGGAGTTGCCTGTATACAATTATCCTCGAGGATAATTGTATACAGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-1127s21c1
Sequence:CCGGGCATTTCCTGCTTATCCAAATCTCGAGATTTGGATAAGCAGGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-682s21c1
Sequence:CCGGTCAGCACGTTCAGGCTTATTCCTCGAGGAATAAGCCTGAACGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-572s1c1
Sequence:CCGGCCACGTCCTTTGGTAGTTAATCTCGAGATTAACTACCAAAGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1712s1c1
Sequence:CCGGGCTTATCCAAATTCAGCAGTTCTCGAGAACTGCTGAATTTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1822s1c1
Sequence:CCGGCGAAGCATACAAATGGTGGTACTCGAGTACCACCATTTGTATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1064s1c1
Sequence:CCGGGCTTATCCAAATTCACCATTTCTCGAGAAATGGTGAATTTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-432s1c1
Sequence:CCGGCCAAAGGCTATGGATTTGTTTCTCGAGAAACAAATCCATAGCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020363
DAZ2 MISSION shRNA Lentiviral Transduction Particles
deleted in azoospermia 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-1176s21c1
Sequence:CCGGAGTTGCCTGTATACAATTATCCTCGAGGATAATTGTATACAGGCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-1127s21c1
Sequence:CCGGGCATTTCCTGCTTATCCAAATCTCGAGATTTGGATAAGCAGGAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020363.2-682s21c1
Sequence:CCGGTCAGCACGTTCAGGCTTATTCCTCGAGGAATAAGCCTGAACGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-572s1c1
Sequence:CCGGCCACGTCCTTTGGTAGTTAATCTCGAGATTAACTACCAAAGGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1712s1c1
Sequence:CCGGGCTTATCCAAATTCAGCAGTTCTCGAGAACTGCTGAATTTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1822s1c1
Sequence:CCGGCGAAGCATACAAATGGTGGTACTCGAGTACCACCATTTGTATGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-1064s1c1
Sequence:CCGGGCTTATCCAAATTCACCATTTCTCGAGAAATGGTGAATTTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020363.1-432s1c1
Sequence:CCGGCCAAAGGCTATGGATTTGTTTCTCGAGAAACAAATCCATAGCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks