EMAIL THIS PAGE TO A FRIEND

DAZ3

deleted in azoospermia 3

Synonyms: pDP1679
Species: Human DAZ3(57054)
UniProtKB ID: Q9NR90, Q2KHN7
Gene ID:
Human(57054) Summary: This gene is a member of the DAZ gene family and is a candidate for the human Y-chromosomal azoospermia factor (AZF). Its expression is restricted to premeiotic germ cells, particularly in spermatogonia. It encodes an RNA-binding protein that is important for spermatogenesis. Four copies of this gene are found on chromosome Y within palindromic duplications; one pair of genes is part of the P2 palindrome and the second pair is part of the P1 palindrome. Each gene contains a 2.4 kb repeat including a 72-bp exon, called the DAZ repeat; the number of DAZ repeats is variable and there are several variations in the sequence of the DAZ repeat. Each copy of the gene also contains a 10.8 kb region that may be amplified; this region includes five exons that encode an RNA recognition motif (RRM) domain. This gene contains one copy of the 10.8 kb repeat. [provided by RefSeq, Jul 2008]
17 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020364 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020364 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012391 predicted 667
2 SASI_Hs01_00012392 predicted 1967
3 SASI_Hs01_00012393 predicted 687
4 SASI_Hs01_00012394 predicted 1821
5 SASI_Hs02_00353314 predicted 676
6 SASI_Hs01_00012396 predicted 1820
7 SASI_Hs01_00012398 predicted 1772
8 SASI_Hs01_00012399 predicted 728
9 SASI_Hs01_00012400 predicted 718
10 SASI_Hs02_00353315 predicted 1951
11 SASI_Hs01_00012395 predicted 1783
12 SASI_Hs01_00012397 predicted 1935
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020364
DAZ3 MISSION shRNA Bacterial Glycerol Stock
deleted in azoospermia 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020364.2-1453s1c1
Sequence:CCGGCCGAAGCATACAAATGGTGGTCTCGAGACCACCATTTGTATGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020364.1-1506s1c1
Sequence:CCGGGTTCAGGTCACCACTGGATATCTCGAGATATCCAGTGGTGACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-2879s1c1
Sequence:CCGGCCCTTCTTTCAATGGCTTCTTCTCGAGAAGAAGCCATTGAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-2324s1c1
Sequence:CCGGCCTTCTCAATGAGTTACCATTCTCGAGAATGGTAACTCATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020364.2-484s1c1
Sequence:CCGGCACAGATACATTTCCATGGTACTCGAGTACCATGGAAATGTATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020364.1-470s1c1
Sequence:CCGGGAAGATAGTAGGATCACAGATCTCGAGATCTGTGATCCTACTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-3063s1c1
Sequence:CCGGGCACCATGACTTTGTCCATTACTCGAGTAATGGACAAAGTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020364.2-1930s21c1
Sequence:CCGGCTGATTTGAAAGCTAACAATTCTCGAGAATTGTTAGCTTTCAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-1023s21c1
Sequence:CCGGCAGTTGCCTGTATACAATTATCTCGAGATAATTGTATACAGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-565s21c1
Sequence:CCGGCACGTCCTTTGGTAGTTAATCCTCGAGGATTAACTACCAAAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-951s21c1
Sequence:CCGGCAGTTCCCTGTATACAATTATCTCGAGATAATTGTATACAGGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020364
DAZ3 MISSION shRNA shRNA Plasmid DNA
deleted in azoospermia 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020364.2-1453s1c1
Sequence:CCGGCCGAAGCATACAAATGGTGGTCTCGAGACCACCATTTGTATGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020364.1-1506s1c1
Sequence:CCGGGTTCAGGTCACCACTGGATATCTCGAGATATCCAGTGGTGACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-2879s1c1
Sequence:CCGGCCCTTCTTTCAATGGCTTCTTCTCGAGAAGAAGCCATTGAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-2324s1c1
Sequence:CCGGCCTTCTCAATGAGTTACCATTCTCGAGAATGGTAACTCATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020364.2-484s1c1
Sequence:CCGGCACAGATACATTTCCATGGTACTCGAGTACCATGGAAATGTATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020364.1-470s1c1
Sequence:CCGGGAAGATAGTAGGATCACAGATCTCGAGATCTGTGATCCTACTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-3063s1c1
Sequence:CCGGGCACCATGACTTTGTCCATTACTCGAGTAATGGACAAAGTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020364.2-1930s21c1
Sequence:CCGGCTGATTTGAAAGCTAACAATTCTCGAGAATTGTTAGCTTTCAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-1023s21c1
Sequence:CCGGCAGTTGCCTGTATACAATTATCTCGAGATAATTGTATACAGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-565s21c1
Sequence:CCGGCACGTCCTTTGGTAGTTAATCCTCGAGGATTAACTACCAAAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-951s21c1
Sequence:CCGGCAGTTCCCTGTATACAATTATCTCGAGATAATTGTATACAGGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020364
DAZ3 MISSION shRNA Lentiviral Transduction Particles
deleted in azoospermia 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020364.2-1453s1c1
Sequence:CCGGCCGAAGCATACAAATGGTGGTCTCGAGACCACCATTTGTATGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020364.1-1506s1c1
Sequence:CCGGGTTCAGGTCACCACTGGATATCTCGAGATATCCAGTGGTGACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-2879s1c1
Sequence:CCGGCCCTTCTTTCAATGGCTTCTTCTCGAGAAGAAGCCATTGAAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152171    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-2324s1c1
Sequence:CCGGCCTTCTCAATGAGTTACCATTCTCGAGAATGGTAACTCATTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020364.2-484s1c1
Sequence:CCGGCACAGATACATTTCCATGGTACTCGAGTACCATGGAAATGTATCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150631    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020364.1-470s1c1
Sequence:CCGGGAAGATAGTAGGATCACAGATCTCGAGATCTGTGATCCTACTATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153130    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020364.2-3063s1c1
Sequence:CCGGGCACCATGACTTTGTCCATTACTCGAGTAATGGACAAAGTCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020364.2-1930s21c1
Sequence:CCGGCTGATTTGAAAGCTAACAATTCTCGAGAATTGTTAGCTTTCAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-1023s21c1
Sequence:CCGGCAGTTGCCTGTATACAATTATCTCGAGATAATTGTATACAGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-565s21c1
Sequence:CCGGCACGTCCTTTGGTAGTTAATCCTCGAGGATTAACTACCAAAGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020364.2-951s21c1
Sequence:CCGGCAGTTCCCTGTATACAATTATCTCGAGATAATTGTATACAGGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks