EMAIL THIS PAGE TO A FRIEND

DAZ4

deleted in azoospermia 4

83 Gene Product Result for
Synonyms: pDP1680 pDP1681
Species: Human DAZ4(57135)
UniProtKB ID: Q86SG3, Q9NR88, Q9NR89
Gene ID:
Human(57135) Summary: This gene is a member of the DAZ gene family and is a candidate for the human Y-chromosomal azoospermia factor (AZF). Its expression is restricted to premeiotic germ cells, particularly in spermatogonia. It encodes an RNA-binding protein that is important for spermatogenesis. Four copies of this gene are found on chromosome Y within palindromic duplications; one pair of genes is part of the P2 palindrome and the second pair is part of the P1 palindrome. Each gene contains a 2.4 kb repeat including a 72-bp exon, called the DAZ repeat; the number of DAZ repeats is variable and there are several variations in the sequence of the DAZ repeat. Each copy of the gene also contains a 10.8 kb region that may be amplified; this region includes five exons that encode an RNA recognition motif (RRM) domain. This gene contains two copies of the 10.8 kb repeat. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1307023 ANTI-DAZ4 (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
AV40243 Anti-DAZ4 antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, horse, guinea pig, pig, canine, bovine, human
immunohistochemistry, western blot pricing
SAB2104498 Anti-DAZ4 antibody produced in rabbit affinity isolated antibody bovine, horse, rabbit, human, rat, guinea pig, mouse, pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020420 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114581 MISSION® esiRNA esiRNA human DAZ3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005375 Rosetta Predictions human pricing
NM_020420 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225945 predicted 1163
2 SASI_Hs01_00225946 predicted 2387
3 SASI_Hs01_00225947 predicted 1178
4 SASI_Hs01_00225948 predicted 2242
5 SASI_Hs02_00304885 predicted 1178
6 SASI_Hs01_00225950 predicted 2249
7 SASI_Hs01_00225952 predicted 2201
8 SASI_Hs01_00225953 predicted 1230
9 SASI_Hs01_00225954 predicted 1222
10 SASI_Hs02_00304886 predicted 2372
11 SASI_Hs01_00225949 predicted 2207
12 SASI_Hs01_00225951 predicted 2355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177459 predicted 693
2 SASI_Hs01_00177460 predicted 1841
3 SASI_Hs01_00177461 predicted 702
4 SASI_Hs01_00177462 predicted 1692
5 SASI_Hs02_00353421 predicted 697
6 SASI_Hs01_00177464 predicted 1697
7 SASI_Hs01_00177466 predicted 1654
8 SASI_Hs01_00177467 predicted 753
9 SASI_Hs01_00177468 predicted 744
10 SASI_Hs02_00353422 predicted 1821
11 SASI_Hs01_00177463 predicted 1655
12 SASI_Hs01_00177465 predicted 1807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020420
DAZ4 MISSION shRNA Bacterial Glycerol Stock
deleted in azoospermia 4
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-381s1c1
Sequence:CCGGGCTGCTTTGGTAGATACGGTTCTCGAGAACCGTATCTACCAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-397s1c1
Sequence:CCGGCGGTTCAGTGAAAGAAGTGAACTCGAGTTCACTTCTTTCACTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1148s1c1
Sequence:CCGGGCTTATCCAAATTCACCAGTTCTCGAGAACTGGTGAATTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-444s1c1
Sequence:CCGGCCAAAGGCTATGGATTTGTTTCTCGAGAAACAAATCCATAGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1004s1c1
Sequence:CCGGGCTTATCCAAGTTCACCATTTCTCGAGAAATGGTGAACTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-640s1c1
Sequence:CCGGGAATCCAAACACTGAAACCTACTCGAGTAGGTTTCAGTGTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-860s1c1
Sequence:CCGGGCTTATCCAAGATCACCATTTCTCGAGAAATGGTGATCTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1334s1c1
Sequence:CCGGGCATACAAATGGTGGTATCTTCTCGAGAAGATACCACCATTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1220s1c1
Sequence:CCGGGCTTATCCAAATTCAGCAGTTCTCGAGAACTGCTGAATTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-584s1c1
Sequence:CCGGCCACGTCCTTTGGTAGTTAATCTCGAGATTAACTACCAAAGGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1330s1c1
Sequence:CCGGCGAAGCATACAAATGGTGGTACTCGAGTACCACCATTTGTATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-700s1c1
Sequence:CCGGCGTTCAGGCTTACTCTGCTTACTCGAGTAAGCAGAGTAAGCCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-540s1c1
Sequence:CCGGGCCCTGCAATCAGGAAACAAACTCGAGTTTGTTTCCTGATTGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-1034s1c1
Sequence:CCGGGCTGGATATCAGTTGCCTGTACTCGAGTACAGGCAACTGATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-476s1c1
Sequence:CCGGGACGTGGATGTCCAGAAGATACTCGAGTATCTTCTGGACATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020420
DAZ4 MISSION shRNA shRNA Plasmid DNA
deleted in azoospermia 4
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-381s1c1
Sequence:CCGGGCTGCTTTGGTAGATACGGTTCTCGAGAACCGTATCTACCAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-397s1c1
Sequence:CCGGCGGTTCAGTGAAAGAAGTGAACTCGAGTTCACTTCTTTCACTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1148s1c1
Sequence:CCGGGCTTATCCAAATTCACCAGTTCTCGAGAACTGGTGAATTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-444s1c1
Sequence:CCGGCCAAAGGCTATGGATTTGTTTCTCGAGAAACAAATCCATAGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1004s1c1
Sequence:CCGGGCTTATCCAAGTTCACCATTTCTCGAGAAATGGTGAACTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-640s1c1
Sequence:CCGGGAATCCAAACACTGAAACCTACTCGAGTAGGTTTCAGTGTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-860s1c1
Sequence:CCGGGCTTATCCAAGATCACCATTTCTCGAGAAATGGTGATCTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1334s1c1
Sequence:CCGGGCATACAAATGGTGGTATCTTCTCGAGAAGATACCACCATTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1220s1c1
Sequence:CCGGGCTTATCCAAATTCAGCAGTTCTCGAGAACTGCTGAATTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-584s1c1
Sequence:CCGGCCACGTCCTTTGGTAGTTAATCTCGAGATTAACTACCAAAGGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1330s1c1
Sequence:CCGGCGAAGCATACAAATGGTGGTACTCGAGTACCACCATTTGTATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-700s1c1
Sequence:CCGGCGTTCAGGCTTACTCTGCTTACTCGAGTAAGCAGAGTAAGCCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-540s1c1
Sequence:CCGGGCCCTGCAATCAGGAAACAAACTCGAGTTTGTTTCCTGATTGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-1034s1c1
Sequence:CCGGGCTGGATATCAGTTGCCTGTACTCGAGTACAGGCAACTGATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-476s1c1
Sequence:CCGGGACGTGGATGTCCAGAAGATACTCGAGTATCTTCTGGACATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020420
DAZ4 MISSION shRNA Lentiviral Transduction Particles
deleted in azoospermia 4
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156515    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-381s1c1
Sequence:CCGGGCTGCTTTGGTAGATACGGTTCTCGAGAACCGTATCTACCAAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-397s1c1
Sequence:CCGGCGGTTCAGTGAAAGAAGTGAACTCGAGTTCACTTCTTTCACTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1148s1c1
Sequence:CCGGGCTTATCCAAATTCACCAGTTCTCGAGAACTGGTGAATTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-444s1c1
Sequence:CCGGCCAAAGGCTATGGATTTGTTTCTCGAGAAACAAATCCATAGCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1004s1c1
Sequence:CCGGGCTTATCCAAGTTCACCATTTCTCGAGAAATGGTGAACTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-640s1c1
Sequence:CCGGGAATCCAAACACTGAAACCTACTCGAGTAGGTTTCAGTGTTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-860s1c1
Sequence:CCGGGCTTATCCAAGATCACCATTTCTCGAGAAATGGTGATCTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1334s1c1
Sequence:CCGGGCATACAAATGGTGGTATCTTCTCGAGAAGATACCACCATTTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1220s1c1
Sequence:CCGGGCTTATCCAAATTCAGCAGTTCTCGAGAACTGCTGAATTTGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-584s1c1
Sequence:CCGGCCACGTCCTTTGGTAGTTAATCTCGAGATTAACTACCAAAGGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-1330s1c1
Sequence:CCGGCGAAGCATACAAATGGTGGTACTCGAGTACCACCATTTGTATGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158257    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-700s1c1
Sequence:CCGGCGTTCAGGCTTACTCTGCTTACTCGAGTAAGCAGAGTAAGCCTGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-540s1c1
Sequence:CCGGGCCCTGCAATCAGGAAACAAACTCGAGTTTGTTTCCTGATTGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020420.1-1034s1c1
Sequence:CCGGGCTGGATATCAGTTGCCTGTACTCGAGTACAGGCAACTGATATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157422    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020420.1-476s1c1
Sequence:CCGGGACGTGGATGTCCAGAAGATACTCGAGTATCTTCTGGACATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks