EMAIL THIS PAGE TO A FRIEND

DAZAP1

DAZ associated protein 1

139 Gene Product Result for
UniProtKB ID: Q96EP5, Q96MJ3, Q9NRR9
Gene ID:
Human(26528) Summary: In mammals, the Y chromosome directs the development of the testes and plays an important role in spermatogenesis. A high percentage of infertile men have deletions that map to regions of the Y chromosome. The DAZ (deleted in azoospermia) gene cluster maps to the AZFc region of the Y chromosome and is deleted in many azoospermic and severely oligospermic men. It is thought that the DAZ gene cluster arose from the transposition, amplification, and pruning of the ancestral autosomal gene DAZL also involved in germ cell development and gametogenesis. This gene encodes a RNA-binding protein with two RNP motifs that was originally identified by its interaction with the infertility factors DAZ and DAZL. Two isoforms are encoded by transcript variants of this gene. [provided by RefSeq, Jul 2008]
Mouse(70248) DAZ associated protein 1
Rat(362836) DAZ associated protein 1
Zebrafish(561459) DAZ associated protein 1
chicken(427266) DAZ associated protein 1
domestic cat(101096952) DAZ associated protein 1
cow(614783) DAZ associated protein 1
dog(100683271) DAZ associated protein 1
sheep(101115209) DAZ associated protein 1
domestic guinea pig(100732237) DAZ associated protein 1
naked mole-rat(101700390) DAZ associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0322 AQUA Peptide GFGFV[K] African clawed frog, chicken, cow, human, mouse, rat pricing
AQ0321 AQUA Peptide GQNHNVQGFHPY[R] African clawed frog, chicken, cow, human, mouse, rat pricing
AQ0323 AQUA Peptide TTNQS[R] African clawed frog, chicken, cow, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018959 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018959 Rosetta Predictions human pricing
NM_170711 Rosetta Predictions human pricing
NM_001025742 Rosetta Predictions rat pricing
NM_001122604 Rosetta Predictions mouse pricing
NM_001122605 Rosetta Predictions mouse pricing
NM_133188 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235931 predicted 874
2 SASI_Hs01_00235932 predicted 289
3 SASI_Hs01_00235933 predicted 539
4 SASI_Hs02_00352434 predicted 562
5 SASI_Hs01_00235935 predicted 329
6 SASI_Hs01_00235936 predicted 320
7 SASI_Hs01_00235937 predicted 503
8 SASI_Hs01_00235938 predicted 405
9 SASI_Hs01_00235939 predicted 961
10 SASI_Hs01_00235940 predicted 330
11 SASI_Hs01_00235934 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110250 predicted 874
2 SASI_Hs01_00110251 predicted 283
3 SASI_Hs01_00110252 predicted 540
4 SASI_Hs01_00110254 predicted 565
5 SASI_Hs01_00110255 predicted 328
6 SASI_Hs01_00110256 predicted 328
7 SASI_Hs01_00110257 predicted 500
8 SASI_Hs02_00367659 predicted 568
9 SASI_Hs01_00110258 predicted 404
10 SASI_Hs01_00110259 predicted 966
11 SASI_Hs01_00110253 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203383 predicted 276
2 SASI_Rn01_00090453 predicted 348
3 SASI_Rn02_00203384 predicted 234
4 SASI_Rn01_00090455 predicted 801
5 SASI_Rn01_00090456 predicted 806
6 SASI_Rn01_00090457 predicted 916
7 SASI_Rn01_00090458 predicted 537
8 SASI_Rn01_00090459 predicted 792
9 SASI_Rn01_00090460 predicted 622
10 SASI_Rn01_00090461 predicted 1301
11 SASI_Rn01_00090454 predicted 545
12 SASI_Rn01_00090462 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309067 predicted 820
2 SASI_Mm02_00309068 predicted 868
3 SASI_Mm02_00309069 predicted 833
4 SASI_Mm02_00309070 predicted 210
5 SASI_Mm02_00309071 predicted 826
6 SASI_Mm02_00309072 predicted 838
7 SASI_Mm02_00309073 predicted 708
8 SASI_Mm02_00309074 predicted 222
9 SASI_Mm02_00309075 predicted 726
10 SASI_Mm02_00309076 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309077 predicted 822
2 SASI_Mm02_00309078 predicted 869
3 SASI_Mm02_00309079 predicted 828
4 SASI_Mm02_00309080 predicted 211
5 SASI_Mm02_00309081 predicted 819
6 SASI_Mm02_00309082 predicted 837
7 SASI_Mm02_00309083 predicted 699
8 SASI_Mm02_00309084 predicted 225
9 SASI_Mm02_00309085 predicted 717
10 SASI_Mm02_00309086 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338362 predicted 1843
2 SASI_Mm02_00338363 predicted 823
3 SASI_Mm02_00338364 predicted 871
4 SASI_Mm01_00164837 predicted 830
5 SASI_Mm02_00338365 predicted 211
6 SASI_Mm02_00338366 predicted 824
7 SASI_Mm01_00164839 predicted 833
8 SASI_Mm01_00164841 predicted 703
9 SASI_Mm02_00338367 predicted 223
10 SASI_Mm02_00338368 predicted 722
11 SASI_Mm01_00164835 predicted 277
12 SASI_Mm01_00164836 predicted 470
13 SASI_Mm01_00164838 predicted 277
14 SASI_Mm01_00164840 predicted 1227
15 SASI_Mm01_00164842 predicted 463
16 SASI_Mm01_00164843 predicted 284
17 SASI_Mm01_00164844 predicted 1093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133188
VALIDATED
DAZAP1 MISSION shRNA Bacterial Glycerol Stock
DAZ associated protein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133188.1-1477s1c1
Sequence:CCGGCCTTCAGCTTTAATTCAGAATCTCGAGATTCTGAATTAAAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-729s1c1
Sequence:CCGGCAACAAGGATATGGCCCACAACTCGAGTTGTGGGCCATATCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-471s1c1
Sequence:CCGGGAGGTGGTTATGATCTATGATCTCGAGATCATAGATCATAACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-271s1c1
Sequence:CCGGACACCCTAGATGGCCGAAATACTCGAGTATTTCGGCCATCTAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133188.1-437s1c1
Sequence:CCGGCAGGGAGTACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTACTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-935s21c1
Sequence:CCGGCACCCTTCACCTCCTACATTGCTCGAGCAATGTAGGAGGTGAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-379s21c1
Sequence:CCGGACCCTAGATGGCCGAAATATCCTCGAGGATATTTCGGCCATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-543s21c1
Sequence:CCGGCAGGGAGTACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTACTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-577s21c1
Sequence:CCGGGAGGTGGTTATGATCTATGATCTCGAGATCATAGATCATAACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-485s21c1
Sequence:CCGGGCAAATCCAACAAGATCTTTGCTCGAGCAAAGATCTTGTTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133188.2-1557s21c1
Sequence:CCGGGGTTCAACAACAGGGTTTAAACTCGAGTTTAAACCCTGTTGTTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133188
VALIDATED
DAZAP1 MISSION shRNA shRNA Plasmid DNA
DAZ associated protein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133188.1-1477s1c1
Sequence:CCGGCCTTCAGCTTTAATTCAGAATCTCGAGATTCTGAATTAAAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-729s1c1
Sequence:CCGGCAACAAGGATATGGCCCACAACTCGAGTTGTGGGCCATATCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-471s1c1
Sequence:CCGGGAGGTGGTTATGATCTATGATCTCGAGATCATAGATCATAACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-271s1c1
Sequence:CCGGACACCCTAGATGGCCGAAATACTCGAGTATTTCGGCCATCTAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133188.1-437s1c1
Sequence:CCGGCAGGGAGTACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTACTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-935s21c1
Sequence:CCGGCACCCTTCACCTCCTACATTGCTCGAGCAATGTAGGAGGTGAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-379s21c1
Sequence:CCGGACCCTAGATGGCCGAAATATCCTCGAGGATATTTCGGCCATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-543s21c1
Sequence:CCGGCAGGGAGTACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTACTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-577s21c1
Sequence:CCGGGAGGTGGTTATGATCTATGATCTCGAGATCATAGATCATAACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-485s21c1
Sequence:CCGGGCAAATCCAACAAGATCTTTGCTCGAGCAAAGATCTTGTTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133188.2-1557s21c1
Sequence:CCGGGGTTCAACAACAGGGTTTAAACTCGAGTTTAAACCCTGTTGTTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133188
VALIDATED
DAZAP1 MISSION shRNA Lentiviral Transduction Particles
DAZ associated protein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133188.1-1477s1c1
Sequence:CCGGCCTTCAGCTTTAATTCAGAATCTCGAGATTCTGAATTAAAGCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-729s1c1
Sequence:CCGGCAACAAGGATATGGCCCACAACTCGAGTTGTGGGCCATATCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-471s1c1
Sequence:CCGGGAGGTGGTTATGATCTATGATCTCGAGATCATAGATCATAACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133188.1-271s1c1
Sequence:CCGGACACCCTAGATGGCCGAAATACTCGAGTATTTCGGCCATCTAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133188.1-437s1c1
Sequence:CCGGCAGGGAGTACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTACTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-935s21c1
Sequence:CCGGCACCCTTCACCTCCTACATTGCTCGAGCAATGTAGGAGGTGAAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-379s21c1
Sequence:CCGGACCCTAGATGGCCGAAATATCCTCGAGGATATTTCGGCCATCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-543s21c1
Sequence:CCGGCAGGGAGTACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTACTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-577s21c1
Sequence:CCGGGAGGTGGTTATGATCTATGATCTCGAGATCATAGATCATAACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133188.2-485s21c1
Sequence:CCGGGCAAATCCAACAAGATCTTTGCTCGAGCAAAGATCTTGTTGGATTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133188.2-1557s21c1
Sequence:CCGGGGTTCAACAACAGGGTTTAAACTCGAGTTTAAACCCTGTTGTTGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018959
VALIDATED
DAZAP1 MISSION shRNA Bacterial Glycerol Stock
DAZ associated protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-502s1c1
Sequence:CCGGCCCAGGAGCGATAACAGTAAACTCGAGTTTACTGTTATCGCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018959.2-1946s1c1
Sequence:CCGGGAAGAAATCTACTGAGTGTATCTCGAGATACACTCAGTAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-576s1c1
Sequence:CCGGCAGGGAATACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTATTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-290s1c1
Sequence:CCGGGAGAAGTCGTAGATTGTGTTACTCGAGTAACACAATCTACGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-503s1c1
Sequence:CCGGCCAGGAGCGATAACAGTAAATCTCGAGATTTACTGTTATCGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-290s21c1
Sequence:CCGGGAGAAGTCGTAGATTGTGTTACTCGAGTAACACAATCTACGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-608s21c1
Sequence:CCGGCGGAGGTAGTCATGATCTATGCTCGAGCATAGATCATGACTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-503s21c1
Sequence:CCGGCCAGGAGCGATAACAGTAAATCTCGAGATTTACTGTTATCGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-576s21c1
Sequence:CCGGCAGGGAATACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTATTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018959.2-1811s21c1
Sequence:CCGGACGATGTATACTGGCTTATTTCTCGAGAAATAAGCCAGTATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018959
VALIDATED
DAZAP1 MISSION shRNA shRNA Plasmid DNA
DAZ associated protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-502s1c1
Sequence:CCGGCCCAGGAGCGATAACAGTAAACTCGAGTTTACTGTTATCGCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018959.2-1946s1c1
Sequence:CCGGGAAGAAATCTACTGAGTGTATCTCGAGATACACTCAGTAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-576s1c1
Sequence:CCGGCAGGGAATACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTATTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-290s1c1
Sequence:CCGGGAGAAGTCGTAGATTGTGTTACTCGAGTAACACAATCTACGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-503s1c1
Sequence:CCGGCCAGGAGCGATAACAGTAAATCTCGAGATTTACTGTTATCGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-290s21c1
Sequence:CCGGGAGAAGTCGTAGATTGTGTTACTCGAGTAACACAATCTACGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-608s21c1
Sequence:CCGGCGGAGGTAGTCATGATCTATGCTCGAGCATAGATCATGACTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-503s21c1
Sequence:CCGGCCAGGAGCGATAACAGTAAATCTCGAGATTTACTGTTATCGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-576s21c1
Sequence:CCGGCAGGGAATACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTATTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018959.2-1811s21c1
Sequence:CCGGACGATGTATACTGGCTTATTTCTCGAGAAATAAGCCAGTATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018959
VALIDATED
DAZAP1 MISSION shRNA Lentiviral Transduction Particles
DAZ associated protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-502s1c1
Sequence:CCGGCCCAGGAGCGATAACAGTAAACTCGAGTTTACTGTTATCGCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159197    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018959.2-1946s1c1
Sequence:CCGGGAAGAAATCTACTGAGTGTATCTCGAGATACACTCAGTAGATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-576s1c1
Sequence:CCGGCAGGGAATACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTATTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-290s1c1
Sequence:CCGGGAGAAGTCGTAGATTGTGTTACTCGAGTAACACAATCTACGACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018959.2-503s1c1
Sequence:CCGGCCAGGAGCGATAACAGTAAATCTCGAGATTTACTGTTATCGCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-290s21c1
Sequence:CCGGGAGAAGTCGTAGATTGTGTTACTCGAGTAACACAATCTACGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-608s21c1
Sequence:CCGGCGGAGGTAGTCATGATCTATGCTCGAGCATAGATCATGACTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-503s21c1
Sequence:CCGGCCAGGAGCGATAACAGTAAATCTCGAGATTTACTGTTATCGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018959.2-576s21c1
Sequence:CCGGCAGGGAATACTTCAAGAAGTTCTCGAGAACTTCTTGAAGTATTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018959.2-1811s21c1
Sequence:CCGGACGATGTATACTGGCTTATTTCTCGAGAAATAAGCCAGTATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks