EMAIL THIS PAGE TO A FRIEND

DAZAP2

DAZ associated protein 2

159 Gene Product Result for
Synonyms: PRTB
Gene ID:
Human(9802) Summary: This gene encodes a proline-rich protein which interacts with the deleted in azoospermia (DAZ) and the deleted in azoospermia-like gene through the DAZ-like repeats. This protein also interacts with the transforming growth factor-beta signaling molecule SARA (Smad anchor for receptor activation), eukaryotic initiation factor 4G, and an E3 ubiquitinase that regulates its stability in splicing factor containing nuclear speckles. The encoded protein may function in various biological and pathological processes including spermatogenesis, cell signaling and transcription regulation, formation of stress granules during translation arrest, RNA splicing, and pathogenesis of multiple myeloma. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(23994) DAZ associated protein 2
Rat(300235) DAZ associated protein 2
naked mole-rat(101715423) DAZ associated protein 2
domestic guinea pig(100717766) DAZ associated protein 2
sheep(101114764) DAZ associated protein 2
Zebrafish(324316) DAZ associated protein 2
dog(477605) DAZ associated protein 2
domestic cat(101091460) DAZ associated protein 2
cow(540286) DAZ associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011873 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011873 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011873 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014764 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106891 MISSION® esiRNA esiRNA human DAZAP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014764 Rosetta Predictions human pricing
NM_001013107 Rosetta Predictions rat pricing
NM_011873 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215737 predicted 854
2 SASI_Hs02_00346248 predicted 969
3 SASI_Hs02_00346249 predicted 832
4 SASI_Hs01_00215739 predicted 839
5 SASI_Hs01_00215740 predicted 967
6 SASI_Hs02_00346250 predicted 965
7 SASI_Hs01_00215742 predicted 730
8 SASI_Hs01_00215743 predicted 892
9 SASI_Hs01_00215744 predicted 911
10 SASI_Hs01_00215746 predicted 901
11 SASI_Hs01_00215738 predicted 635
12 SASI_Hs01_00215741 predicted 392
13 SASI_Hs01_00215745 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200790 predicted 916
2 SASI_Rn01_00040386 predicted 566
3 SASI_Rn01_00040387 predicted 939
4 SASI_Rn01_00040388 predicted 880
5 SASI_Rn01_00040389 predicted 542
6 SASI_Rn01_00040390 predicted 717
7 SASI_Rn01_00040391 predicted 478
8 SASI_Rn01_00040392 predicted 325
9 SASI_Rn01_00040394 predicted 367
10 SASI_Rn01_00040395 predicted 836
11 SASI_Rn01_00040393 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114432 predicted 757
2 SASI_Mm01_00114433 predicted 614
3 SASI_Mm01_00114434 predicted 910
4 SASI_Mm01_00114435 predicted 614
5 SASI_Mm01_00114436 predicted 740
6 SASI_Mm01_00114437 predicted 940
7 SASI_Mm02_00321660 predicted 983
8 SASI_Mm01_00114439 predicted 844
9 SASI_Mm01_00114440 predicted 973
10 SASI_Mm02_00321661 predicted 767
11 SASI_Mm01_00114431 predicted 960
12 SASI_Mm01_00114438 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011873
VALIDATED
DAZAP2 MISSION shRNA Bacterial Glycerol Stock
DAZ associated protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-852s21c1
Sequence:CCGGGGTCTTTGCTTCTAGTAATAACTCGAGTTATTACTAGAAGCAAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-618s21c1
Sequence:CCGGGTAACTGCTTTAGTCATATTACTCGAGTAATATGACTAAAGCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-312s21c1
Sequence:CCGGCCCATGGCTTATTATCCAGTTCTCGAGAACTGGATAATAAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-111s21c1
Sequence:CCGGCCAGTATATCCTCAGACCTTACTCGAGTAAGGTCTGAGGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-488s21c1
Sequence:CCGGCGTCCTTGTAACTCAGCGCAACTCGAGTTGCGCTGAGTTACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-488s1c1
Sequence:CCGGCGTCCTTGTAACTCAGCGCAACTCGAGTTGCGCTGAGTTACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-251s1c1
Sequence:CCGGCGCCTCATTGTATCTGCCTATCTCGAGATAGGCAGATACAATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-312s1c1
Sequence:CCGGCCCATGGCTTATTATCCAGTTCTCGAGAACTGGATAATAAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-111s1c1
Sequence:CCGGCCAGTATATCCTCAGACCTTACTCGAGTAAGGTCTGAGGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-747s1c1
Sequence:CCGGCCCTAAAGCATTCTGAGGTAACTCGAGTTACCTCAGAATGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011873
VALIDATED
DAZAP2 MISSION shRNA shRNA Plasmid DNA
DAZ associated protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-852s21c1
Sequence:CCGGGGTCTTTGCTTCTAGTAATAACTCGAGTTATTACTAGAAGCAAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-618s21c1
Sequence:CCGGGTAACTGCTTTAGTCATATTACTCGAGTAATATGACTAAAGCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-312s21c1
Sequence:CCGGCCCATGGCTTATTATCCAGTTCTCGAGAACTGGATAATAAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-111s21c1
Sequence:CCGGCCAGTATATCCTCAGACCTTACTCGAGTAAGGTCTGAGGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-488s21c1
Sequence:CCGGCGTCCTTGTAACTCAGCGCAACTCGAGTTGCGCTGAGTTACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-488s1c1
Sequence:CCGGCGTCCTTGTAACTCAGCGCAACTCGAGTTGCGCTGAGTTACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-251s1c1
Sequence:CCGGCGCCTCATTGTATCTGCCTATCTCGAGATAGGCAGATACAATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-312s1c1
Sequence:CCGGCCCATGGCTTATTATCCAGTTCTCGAGAACTGGATAATAAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-111s1c1
Sequence:CCGGCCAGTATATCCTCAGACCTTACTCGAGTAAGGTCTGAGGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-747s1c1
Sequence:CCGGCCCTAAAGCATTCTGAGGTAACTCGAGTTACCTCAGAATGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011873
VALIDATED
DAZAP2 MISSION shRNA Lentiviral Transduction Particles
DAZ associated protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-852s21c1
Sequence:CCGGGGTCTTTGCTTCTAGTAATAACTCGAGTTATTACTAGAAGCAAAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304587    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-618s21c1
Sequence:CCGGGTAACTGCTTTAGTCATATTACTCGAGTAATATGACTAAAGCAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301927    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-312s21c1
Sequence:CCGGCCCATGGCTTATTATCCAGTTCTCGAGAACTGGATAATAAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-111s21c1
Sequence:CCGGCCAGTATATCCTCAGACCTTACTCGAGTAAGGTCTGAGGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011873.2-488s21c1
Sequence:CCGGCGTCCTTGTAACTCAGCGCAACTCGAGTTGCGCTGAGTTACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-488s1c1
Sequence:CCGGCGTCCTTGTAACTCAGCGCAACTCGAGTTGCGCTGAGTTACAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-251s1c1
Sequence:CCGGCGCCTCATTGTATCTGCCTATCTCGAGATAGGCAGATACAATGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-312s1c1
Sequence:CCGGCCCATGGCTTATTATCCAGTTCTCGAGAACTGGATAATAAGCCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-111s1c1
Sequence:CCGGCCAGTATATCCTCAGACCTTACTCGAGTAAGGTCTGAGGATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011873.2-747s1c1
Sequence:CCGGCCCTAAAGCATTCTGAGGTAACTCGAGTTACCTCAGAATGCTTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014764
VALIDATED
DAZAP2 MISSION shRNA Bacterial Glycerol Stock
DAZ associated protein 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1208s21c1
Sequence:CCGGGCCAGTCTCCATTGAATCAATCTCGAGATTGATTCAATGGAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1027s21c1
Sequence:CCGGGAGGGAACTTTGATCTTCCTACTCGAGTAGGAAGATCAAAGTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1683s21c1
Sequence:CCGGCTGGGTTAATAGGGTCATATTCTCGAGAATATGACCCTATTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1412s21c1
Sequence:CCGGCCTCATAGGTTGTCTCTGCATCTCGAGATGCAGAGACAACCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1881s21c1
Sequence:CCGGCCATTGACTGTTATGGAAGTTCTCGAGAACTTCCATAACAGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143959    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014764.2-1617s1c1
Sequence:CCGGCAGTGAAATCTCATTAGGGTTCTCGAGAACCCTAATGAGATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1090s1c1
Sequence:CCGGGCCAGTCTCCATTGAATCAATCTCGAGATTGATTCAATGGAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1763s1c1
Sequence:CCGGCCATTGACTGTTATGGAAGTTCTCGAGAACTTCCATAACAGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014764.2-130s1c1
Sequence:CCGGGTATACCCTCAGACCTTGCATCTCGAGATGCAAGGTCTGAGGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014764.2-528s1c1
Sequence:CCGGGAACTTCTTCATGGGTGGTTCCTCGAGGAACCACCCATGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1294s1c1
Sequence:CCGGCCTCATAGGTTGTCTCTGCATCTCGAGATGCAGAGACAACCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-909s1c1
Sequence:CCGGGAGGGAACTTTGATCTTCCTACTCGAGTAGGAAGATCAAAGTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1565s1c1
Sequence:CCGGCTGGGTTAATAGGGTCATATTCTCGAGAATATGACCCTATTAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014764
VALIDATED
DAZAP2 MISSION shRNA shRNA Plasmid DNA
DAZ associated protein 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1208s21c1
Sequence:CCGGGCCAGTCTCCATTGAATCAATCTCGAGATTGATTCAATGGAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1027s21c1
Sequence:CCGGGAGGGAACTTTGATCTTCCTACTCGAGTAGGAAGATCAAAGTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1683s21c1
Sequence:CCGGCTGGGTTAATAGGGTCATATTCTCGAGAATATGACCCTATTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1412s21c1
Sequence:CCGGCCTCATAGGTTGTCTCTGCATCTCGAGATGCAGAGACAACCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1881s21c1
Sequence:CCGGCCATTGACTGTTATGGAAGTTCTCGAGAACTTCCATAACAGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143959    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014764.2-1617s1c1
Sequence:CCGGCAGTGAAATCTCATTAGGGTTCTCGAGAACCCTAATGAGATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1090s1c1
Sequence:CCGGGCCAGTCTCCATTGAATCAATCTCGAGATTGATTCAATGGAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1763s1c1
Sequence:CCGGCCATTGACTGTTATGGAAGTTCTCGAGAACTTCCATAACAGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014764.2-130s1c1
Sequence:CCGGGTATACCCTCAGACCTTGCATCTCGAGATGCAAGGTCTGAGGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014764.2-528s1c1
Sequence:CCGGGAACTTCTTCATGGGTGGTTCCTCGAGGAACCACCCATGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1294s1c1
Sequence:CCGGCCTCATAGGTTGTCTCTGCATCTCGAGATGCAGAGACAACCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-909s1c1
Sequence:CCGGGAGGGAACTTTGATCTTCCTACTCGAGTAGGAAGATCAAAGTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1565s1c1
Sequence:CCGGCTGGGTTAATAGGGTCATATTCTCGAGAATATGACCCTATTAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014764
VALIDATED
DAZAP2 MISSION shRNA Lentiviral Transduction Particles
DAZ associated protein 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1208s21c1
Sequence:CCGGGCCAGTCTCCATTGAATCAATCTCGAGATTGATTCAATGGAGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1027s21c1
Sequence:CCGGGAGGGAACTTTGATCTTCCTACTCGAGTAGGAAGATCAAAGTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1683s21c1
Sequence:CCGGCTGGGTTAATAGGGTCATATTCTCGAGAATATGACCCTATTAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278226    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1412s21c1
Sequence:CCGGCCTCATAGGTTGTCTCTGCATCTCGAGATGCAGAGACAACCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297411    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014764.3-1881s21c1
Sequence:CCGGCCATTGACTGTTATGGAAGTTCTCGAGAACTTCCATAACAGTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143959    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014764.2-1617s1c1
Sequence:CCGGCAGTGAAATCTCATTAGGGTTCTCGAGAACCCTAATGAGATTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1090s1c1
Sequence:CCGGGCCAGTCTCCATTGAATCAATCTCGAGATTGATTCAATGGAGACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1763s1c1
Sequence:CCGGCCATTGACTGTTATGGAAGTTCTCGAGAACTTCCATAACAGTCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014764.2-130s1c1
Sequence:CCGGGTATACCCTCAGACCTTGCATCTCGAGATGCAAGGTCTGAGGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014764.2-528s1c1
Sequence:CCGGGAACTTCTTCATGGGTGGTTCCTCGAGGAACCACCCATGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1294s1c1
Sequence:CCGGCCTCATAGGTTGTCTCTGCATCTCGAGATGCAGAGACAACCTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-909s1c1
Sequence:CCGGGAGGGAACTTTGATCTTCCTACTCGAGTAGGAAGATCAAAGTTCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014764.2-1565s1c1
Sequence:CCGGCTGGGTTAATAGGGTCATATTCTCGAGAATATGACCCTATTAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks