EMAIL THIS PAGE TO A FRIEND

DAZL

deleted in azoospermia-like

155 Gene Product Result for
Synonyms: DAZH DAZL1 DAZLA SPGYLA
UniProtKB ID: Q92904, O15396, Q5HYB4, Q92909
Gene ID:
Human(1618) Summary: The DAZ (Deleted in AZoospermia) gene family encodes potential RNA binding proteins that are expressed in prenatal and postnatal germ cells of males and females. The protein encoded by this gene is localized to the nucleus and cytoplasm of fetal germ cells and to the cytoplasm of developing oocytes. In the testis, this protein is localized to the nucleus of spermatogonia but relocates to the cytoplasm during meiosis where it persists in spermatids and spermatozoa. Transposition and amplification of this autosomal gene during primate evolution gave rise to the DAZ gene cluster on the Y chromosome. Mutations in this gene have been linked to severe spermatogenic failure and infertility in males. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(13164) deleted in azoospermia-like
Rat(680486) deleted in azoospermia-like
Zebrafish(58039) deleted in azoospermia-like
chicken(374054) deleted in azoospermia-like
cow(530116) deleted in azoospermia-like
dog(477055) deleted in azoospermia-like
sheep(100885769) deleted in azoospermia-like
domestic guinea pig(100722319) deleted in azoospermia-like
naked mole-rat(101723796) deleted in azoospermia-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001351 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001351 Rosetta Predictions human pricing
NM_001109414 Rosetta Predictions rat pricing
NM_010021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210219 predicted 789
2 SASI_Hs01_00210220 predicted 703
3 SASI_Hs01_00210221 predicted 1110
4 SASI_Hs01_00210222 predicted 717
5 SASI_Hs01_00210223 predicted 956
6 SASI_Hs01_00210224 predicted 1175
7 SASI_Hs01_00210225 predicted 1191
8 SASI_Hs01_00210227 predicted 916
9 SASI_Hs01_00210228 predicted 921
10 SASI_Hs02_00331680 predicted 461
11 SASI_Hs01_00210226 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248177 predicted 673
2 SASI_Rn02_00248178 predicted 760
3 SASI_Rn02_00248179 predicted 200
4 SASI_Rn02_00248180 predicted 615
5 SASI_Rn02_00248181 predicted 966
6 SASI_Rn02_00248182 predicted 751
7 SASI_Rn02_00248183 predicted 823
8 SASI_Rn02_00248184 predicted 915
9 SASI_Rn02_00248185 predicted 784
10 SASI_Rn02_00248186 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044379 predicted 665
2 SASI_Mm01_00044381 predicted 601
3 SASI_Mm01_00044382 predicted 611
4 SASI_Mm01_00044383 predicted 614
5 SASI_Mm01_00044384 predicted 1007
6 SASI_Mm01_00044385 predicted 470
7 SASI_Mm01_00044386 predicted 354
8 SASI_Mm01_00044387 predicted 959
9 SASI_Mm02_00317644 predicted 370
10 SASI_Mm02_00317645 predicted 867
11 SASI_Mm01_00044380 predicted 974
12 SASI_Mm01_00044388 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010021
DAZL MISSION shRNA Bacterial Glycerol Stock
deleted in azoospermia-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010021.2-2425s1c1
Sequence:CCGGGCCTTGTTGATCTATCTTGTACTCGAGTACAAGATAGATCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-743s1c1
Sequence:CCGGGCCTGTTTATAACTACCAGATCTCGAGATCTGGTAGTTATAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-870s1c1
Sequence:CCGGCCCAATGAATGTTCAGTTCATCTCGAGATGAACTGAACATTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-265s1c1
Sequence:CCGGCCACAAGTCAAGGATATGTTTCTCGAGAAACATATCCTTGACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-808s1c1
Sequence:CCGGCTCCGGCTTATACAACTGTTACTCGAGTAACAGTTGTATAAGCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010021
DAZL MISSION shRNA shRNA Plasmid DNA
deleted in azoospermia-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010021.2-2425s1c1
Sequence:CCGGGCCTTGTTGATCTATCTTGTACTCGAGTACAAGATAGATCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-743s1c1
Sequence:CCGGGCCTGTTTATAACTACCAGATCTCGAGATCTGGTAGTTATAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-870s1c1
Sequence:CCGGCCCAATGAATGTTCAGTTCATCTCGAGATGAACTGAACATTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-265s1c1
Sequence:CCGGCCACAAGTCAAGGATATGTTTCTCGAGAAACATATCCTTGACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-808s1c1
Sequence:CCGGCTCCGGCTTATACAACTGTTACTCGAGTAACAGTTGTATAAGCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010021
DAZL MISSION shRNA Lentiviral Transduction Particles
deleted in azoospermia-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102500    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010021.2-2425s1c1
Sequence:CCGGGCCTTGTTGATCTATCTTGTACTCGAGTACAAGATAGATCAACAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-743s1c1
Sequence:CCGGGCCTGTTTATAACTACCAGATCTCGAGATCTGGTAGTTATAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-870s1c1
Sequence:CCGGCCCAATGAATGTTCAGTTCATCTCGAGATGAACTGAACATTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-265s1c1
Sequence:CCGGCCACAAGTCAAGGATATGTTTCTCGAGAAACATATCCTTGACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010021.2-808s1c1
Sequence:CCGGCTCCGGCTTATACAACTGTTACTCGAGTAACAGTTGTATAAGCCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001351
DAZL MISSION shRNA Bacterial Glycerol Stock
deleted in azoospermia-like
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-970s1c1
Sequence:CCGGGTGCCAAATGAATGTTCAGTTCTCGAGAACTGAACATTCATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-1146s1c1
Sequence:CCGGCTTTAGAAGAAGTCGGGCAATCTCGAGATTGCCCGACTTCTTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-467s1c1
Sequence:CCGGGCTTCTTTGCTAGATATGGTTCTCGAGAACCATATCTAGCAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-925s1c1
Sequence:CCGGGCTGTTAACTACCACTGTAATCTCGAGATTACAGTGGTAGTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001351.2-2714s1c1
Sequence:CCGGGCACTATGAATTTGTCCATTTCTCGAGAAATGGACAAATTCATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001351.2-758s21c1
Sequence:CCGGCAACCACGATGAATCCTATAACTCGAGTTATAGGATTCATCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001351.2-902s21c1
Sequence:CCGGATGTTGTACCTCCGGCTTATTCTCGAGAATAAGCCGGAGGTACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001351
DAZL MISSION shRNA shRNA Plasmid DNA
deleted in azoospermia-like
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-970s1c1
Sequence:CCGGGTGCCAAATGAATGTTCAGTTCTCGAGAACTGAACATTCATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-1146s1c1
Sequence:CCGGCTTTAGAAGAAGTCGGGCAATCTCGAGATTGCCCGACTTCTTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-467s1c1
Sequence:CCGGGCTTCTTTGCTAGATATGGTTCTCGAGAACCATATCTAGCAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-925s1c1
Sequence:CCGGGCTGTTAACTACCACTGTAATCTCGAGATTACAGTGGTAGTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001351.2-2714s1c1
Sequence:CCGGGCACTATGAATTTGTCCATTTCTCGAGAAATGGACAAATTCATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001351.2-758s21c1
Sequence:CCGGCAACCACGATGAATCCTATAACTCGAGTTATAGGATTCATCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001351.2-902s21c1
Sequence:CCGGATGTTGTACCTCCGGCTTATTCTCGAGAATAAGCCGGAGGTACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001351
DAZL MISSION shRNA Lentiviral Transduction Particles
deleted in azoospermia-like
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-970s1c1
Sequence:CCGGGTGCCAAATGAATGTTCAGTTCTCGAGAACTGAACATTCATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-1146s1c1
Sequence:CCGGCTTTAGAAGAAGTCGGGCAATCTCGAGATTGCCCGACTTCTTCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-467s1c1
Sequence:CCGGGCTTCTTTGCTAGATATGGTTCTCGAGAACCATATCTAGCAAAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001351.2-925s1c1
Sequence:CCGGGCTGTTAACTACCACTGTAATCTCGAGATTACAGTGGTAGTTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001351.2-2714s1c1
Sequence:CCGGGCACTATGAATTTGTCCATTTCTCGAGAAATGGACAAATTCATAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001351.2-758s21c1
Sequence:CCGGCAACCACGATGAATCCTATAACTCGAGTTATAGGATTCATCGTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001351.2-902s21c1
Sequence:CCGGATGTTGTACCTCCGGCTTATTCTCGAGAATAAGCCGGAGGTACAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks