EMAIL THIS PAGE TO A FRIEND

DBF4

DBF4 homolog (S. cerevisiae)

95 Gene Product Result for
Synonyms: ASK CHIF DBF4A ZDBF1
Gene ID:
Mouse(27214) DBF4 homolog (S. cerevisiae)
Rat(312046) DBF4 homolog (S. cerevisiae)
sheep(101111186) DBF4 homolog (S. cerevisiae)
Domestic Rabbit(100339152) DBF4 homolog (S. cerevisiae)
domestic guinea pig(100726964) DBF4 homolog (S. cerevisiae)
naked mole-rat(101706943) DBF4 homolog (S. cerevisiae)
Zebrafish(799015) DBF4 homolog (S. cerevisiae)
domestic cat(101098126) DBF4 homolog (S. cerevisiae)
Horse(100050313) DBF4 homolog (S. cerevisiae)
dog(475219) DBF4 homolog (S. cerevisiae)
chicken(420536) DBF4 homolog (S. cerevisiae)
cow(510916) DBF4 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006716 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006716 Rosetta Predictions human pricing
XM_001066881 Rosetta Predictions rat pricing
XM_231388 Rosetta Predictions rat pricing
NM_013726 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342145 predicted 2295
2 SASI_Hs02_00342146 predicted 1889
3 SASI_Hs02_00342147 predicted 2177
4 SASI_Hs02_00342148 predicted 2173
5 SASI_Hs01_00241873 predicted 870
6 SASI_Hs02_00342149 predicted 2093
7 SASI_Hs01_00241876 predicted 933
8 SASI_Hs02_00342150 predicted 1949
9 SASI_Hs02_00342151 predicted 2185
10 SASI_Hs02_00342152 predicted 1874
11 SASI_Hs01_00241871 predicted 965
12 SASI_Hs01_00241872 predicted 1169
13 SASI_Hs01_00241874 predicted 1452
14 SASI_Hs01_00241875 predicted 1654
15 SASI_Hs01_00241877 predicted 1345
16 SASI_Hs01_00241878 predicted 1629
17 SASI_Hs01_00241879 predicted 1289
18 SASI_Hs01_00241880 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319039 predicted 2543
2 SASI_Rn02_00319040 predicted 1157
3 SASI_Rn02_00319041 predicted 958
4 SASI_Rn02_00319042 predicted 1358
5 SASI_Rn02_00319043 predicted 1269
6 SASI_Rn02_00319044 predicted 1232
7 SASI_Rn02_00319045 predicted 1408
8 SASI_Rn02_00319046 predicted 2038
9 SASI_Rn02_00319047 predicted 2452
10 SASI_Rn02_00319048 predicted 1968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231388 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386764 predicted 1751
2 SASI_Rn02_00386765 predicted 1645
3 SASI_Rn02_00386766 predicted 1248
4 SASI_Rn02_00386767 predicted 1039
5 SASI_Rn02_00386768 predicted 1657
6 SASI_Rn02_00386769 predicted 1800
7 SASI_Rn02_00386770 predicted 1972
8 SASI_Rn02_00386771 predicted 1176
9 SASI_Rn02_00386772 predicted 1656
10 SASI_Rn02_00386773 predicted 2002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013726 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155359 predicted 901
2 SASI_Mm01_00155360 predicted 932
3 SASI_Mm01_00155361 predicted 457
4 SASI_Mm01_00155362 predicted 1520
5 SASI_Mm01_00155363 predicted 252
6 SASI_Mm01_00155364 predicted 553
7 SASI_Mm01_00155365 predicted 1729
8 SASI_Mm01_00155366 predicted 1683
9 SASI_Mm01_00155367 predicted 485
10 SASI_Mm01_00155368 predicted 968
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013726
VALIDATED
DBF4 MISSION shRNA Bacterial Glycerol Stock
DBF4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013726.2-907s21c1
Sequence:CCGGTAATATGGACGGCGATAAATGCTCGAGCATTTATCGCCGTCCATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013726.2-2110s21c1
Sequence:CCGGGACAGCTATATTCCTGAAGTTCTCGAGAACTTCAGGAATATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013726.2-809s21c1
Sequence:CCGGCTGCCGTGTATAAACTACTTTCTCGAGAAAGTAGTTTATACACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013726.2-1521s21c1
Sequence:CCGGCGCAGTCATGTGGACAAGTTTCTCGAGAAACTTGTCCACATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013726.1-2110s1c1
Sequence:CCGGGACAGCTATATTCCTGAAGTTCTCGAGAACTTCAGGAATATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-812s1c1
Sequence:CCGGCCGTGTATAAACTACTTTCTTCTCGAGAAGAAAGTAGTTTATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-1521s1c1
Sequence:CCGGCGCAGTCATGTGGACAAGTTTCTCGAGAAACTTGTCCACATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-1274s1c1
Sequence:CCGGCCGAACTCTCAGTATGAAGAACTCGAGTTCTTCATACTGAGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-809s1c1
Sequence:CCGGCTGCCGTGTATAAACTACTTTCTCGAGAAAGTAGTTTATACACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013726
VALIDATED
DBF4 MISSION shRNA shRNA Plasmid DNA
DBF4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013726.2-907s21c1
Sequence:CCGGTAATATGGACGGCGATAAATGCTCGAGCATTTATCGCCGTCCATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013726.2-2110s21c1
Sequence:CCGGGACAGCTATATTCCTGAAGTTCTCGAGAACTTCAGGAATATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013726.2-809s21c1
Sequence:CCGGCTGCCGTGTATAAACTACTTTCTCGAGAAAGTAGTTTATACACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013726.2-1521s21c1
Sequence:CCGGCGCAGTCATGTGGACAAGTTTCTCGAGAAACTTGTCCACATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013726.1-2110s1c1
Sequence:CCGGGACAGCTATATTCCTGAAGTTCTCGAGAACTTCAGGAATATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-812s1c1
Sequence:CCGGCCGTGTATAAACTACTTTCTTCTCGAGAAGAAAGTAGTTTATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-1521s1c1
Sequence:CCGGCGCAGTCATGTGGACAAGTTTCTCGAGAAACTTGTCCACATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-1274s1c1
Sequence:CCGGCCGAACTCTCAGTATGAAGAACTCGAGTTCTTCATACTGAGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-809s1c1
Sequence:CCGGCTGCCGTGTATAAACTACTTTCTCGAGAAAGTAGTTTATACACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013726
VALIDATED
DBF4 MISSION shRNA Lentiviral Transduction Particles
DBF4 homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013726.2-907s21c1
Sequence:CCGGTAATATGGACGGCGATAAATGCTCGAGCATTTATCGCCGTCCATATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013726.2-2110s21c1
Sequence:CCGGGACAGCTATATTCCTGAAGTTCTCGAGAACTTCAGGAATATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013726.2-809s21c1
Sequence:CCGGCTGCCGTGTATAAACTACTTTCTCGAGAAAGTAGTTTATACACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013726.2-1521s21c1
Sequence:CCGGCGCAGTCATGTGGACAAGTTTCTCGAGAAACTTGTCCACATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013726.1-2110s1c1
Sequence:CCGGGACAGCTATATTCCTGAAGTTCTCGAGAACTTCAGGAATATAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-812s1c1
Sequence:CCGGCCGTGTATAAACTACTTTCTTCTCGAGAAGAAAGTAGTTTATACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-1521s1c1
Sequence:CCGGCGCAGTCATGTGGACAAGTTTCTCGAGAAACTTGTCCACATGACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-1274s1c1
Sequence:CCGGCCGAACTCTCAGTATGAAGAACTCGAGTTCTTCATACTGAGAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013726.1-809s1c1
Sequence:CCGGCTGCCGTGTATAAACTACTTTCTCGAGAAAGTAGTTTATACACGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006716
DBF4 MISSION shRNA Bacterial Glycerol Stock
DBF4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1766s21c1
Sequence:CCGGATGAATTGAGAGGGCTTAATGCTCGAGCATTAAGCCCTCTCAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006716.3-3028s21c1
Sequence:CCGGGTGCTGAGTAATTAGATTATGCTCGAGCATAATCTAATTACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1180s21c1
Sequence:GTACCGGAGCCAACTTTATAGGCCATTTCTCGAGAAATGGCCTATAAAGTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1933s21c1
Sequence:CCGGCTAAGGGTAGATCACTATAAACTCGAGTTTATAGTGATCTACCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-792s21c1
Sequence:CCGGACAAACCTTGGGTCGAATTTCCTCGAGGAAATTCGACCCAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1459s1c1
Sequence:CCGGGCACAGAGTAACCAGTATCAACTCGAGTTGATACTGGTTACTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1438s1c1
Sequence:CCGGAGTGAGCAACACAGAAACTTTCTCGAGAAAGTTTCTGTGTTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-820s1c1
Sequence:CCGGCCAAGTCCAGAATCTGCATATCTCGAGATATGCAGATTCTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-790s1c1
Sequence:CCGGGCACAAACCTTGGGTCGAATTCTCGAGAATTCGACCCAAGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1313s1c1
Sequence:CCGGGAATCCAAACAGATGGCGATACTCGAGTATCGCCATCTGTTTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006716
DBF4 MISSION shRNA shRNA Plasmid DNA
DBF4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1766s21c1
Sequence:CCGGATGAATTGAGAGGGCTTAATGCTCGAGCATTAAGCCCTCTCAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006716.3-3028s21c1
Sequence:CCGGGTGCTGAGTAATTAGATTATGCTCGAGCATAATCTAATTACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1180s21c1
Sequence:GTACCGGAGCCAACTTTATAGGCCATTTCTCGAGAAATGGCCTATAAAGTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1933s21c1
Sequence:CCGGCTAAGGGTAGATCACTATAAACTCGAGTTTATAGTGATCTACCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-792s21c1
Sequence:CCGGACAAACCTTGGGTCGAATTTCCTCGAGGAAATTCGACCCAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1459s1c1
Sequence:CCGGGCACAGAGTAACCAGTATCAACTCGAGTTGATACTGGTTACTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1438s1c1
Sequence:CCGGAGTGAGCAACACAGAAACTTTCTCGAGAAAGTTTCTGTGTTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-820s1c1
Sequence:CCGGCCAAGTCCAGAATCTGCATATCTCGAGATATGCAGATTCTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-790s1c1
Sequence:CCGGGCACAAACCTTGGGTCGAATTCTCGAGAATTCGACCCAAGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1313s1c1
Sequence:CCGGGAATCCAAACAGATGGCGATACTCGAGTATCGCCATCTGTTTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006716
DBF4 MISSION shRNA Lentiviral Transduction Particles
DBF4 homolog (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1766s21c1
Sequence:CCGGATGAATTGAGAGGGCTTAATGCTCGAGCATTAAGCCCTCTCAATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006716.3-3028s21c1
Sequence:CCGGGTGCTGAGTAATTAGATTATGCTCGAGCATAATCTAATTACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1180s21c1
Sequence:GTACCGGAGCCAACTTTATAGGCCATTTCTCGAGAAATGGCCTATAAAGTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-1933s21c1
Sequence:CCGGCTAAGGGTAGATCACTATAAACTCGAGTTTATAGTGATCTACCCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006716.3-792s21c1
Sequence:CCGGACAAACCTTGGGTCGAATTTCCTCGAGGAAATTCGACCCAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1459s1c1
Sequence:CCGGGCACAGAGTAACCAGTATCAACTCGAGTTGATACTGGTTACTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1438s1c1
Sequence:CCGGAGTGAGCAACACAGAAACTTTCTCGAGAAAGTTTCTGTGTTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-820s1c1
Sequence:CCGGCCAAGTCCAGAATCTGCATATCTCGAGATATGCAGATTCTGGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-790s1c1
Sequence:CCGGGCACAAACCTTGGGTCGAATTCTCGAGAATTCGACCCAAGGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006716.3-1313s1c1
Sequence:CCGGGAATCCAAACAGATGGCGATACTCGAGTATCGCCATCTGTTTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks