EMAIL THIS PAGE TO A FRIEND

DBF4B

DBF4 homolog B (S. cerevisiae)

49 Gene Product Result for
Synonyms: ASKL1 CHIFB DRF1 ZDBF1B
UniProtKB ID: Q8NFT6, D3DX56, Q8TEX0, Q96B19, Q9H912
Gene ID:
Human(80174) Summary: This gene encodes a regulator of the cell division cycle 7 homolog (S. cerevisiae) protein, a serine-threonine kinase which links cell cycle regulation to genome duplication. This protein localizes to the nucleus and, in complex with the cell division cycle 7 homolog (S. cerevisiae) protein, may facilitate M phase progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
chicken(771128) DBF4 homolog B (S. cerevisiae)
dog(480497) DBF4 homolog B (S. cerevisiae)
domestic cat(101085761) DBF4 homolog B (S. cerevisiae)
cow(615016) DBF4 homolog B (S. cerevisiae)
sheep(101117684) DBF4 homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145663 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145663 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145663 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025104 Rosetta Predictions human pricing
NM_145663 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194943 predicted 216
2 SASI_Hs01_00194944 predicted 236
3 SASI_Hs01_00194945 predicted 289
4 SASI_Hs02_00357806 predicted 250
5 SASI_Hs02_00357807 predicted 379
6 SASI_Hs01_00194946 predicted 368
7 SASI_Hs01_00194947 predicted 252
8 SASI_Hs01_00194948 predicted 381
9 SASI_Hs01_00194949 predicted 249
10 SASI_Hs01_00194950 predicted 212
11 SASI_Hs01_00194951 predicted 234
12 SASI_Hs01_00194952 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133770 predicted 220
2 SASI_Hs01_00133771 predicted 238
3 SASI_Hs01_00133772 predicted 286
4 SASI_Hs02_00365284 predicted 248
5 SASI_Hs02_00365285 predicted 376
6 SASI_Hs01_00133773 predicted 373
7 SASI_Hs01_00133774 predicted 253
8 SASI_Hs01_00133775 predicted 380
9 SASI_Hs01_00133776 predicted 246
10 SASI_Hs01_00133777 predicted 218
11 SASI_Hs01_00133778 predicted 234
12 SASI_Hs01_00133779 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145663
VALIDATED
DBF4B MISSION shRNA Bacterial Glycerol Stock
DBF4 homolog B (S. cerevisiae)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_145663.1-859s1c1
Sequence:CCGGGCAGAGTCAAGAACACGGAAACTCGAGTTTCCGTGTTCTTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145663.1-913s1c1
Sequence:CCGGGAAGATGAAAGCAGGAAGTTTCTCGAGAAACTTCCTGCTTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2608s1c1
Sequence:CCGGGTGACCAAAGTTGGTTCCTTTCTCGAGAAAGGAACCAACTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2556s1c1
Sequence:CCGGCCTGAAGCATTCCACTAAGATCTCGAGATCTTAGTGGAATGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2574s1c1
Sequence:CCGGGATCATCTATTCCAAGGTCATCTCGAGATGACCTTGGAATAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145663.1-1828s21c1
Sequence:CCGGCTCAGACTTGGATACCTTTACCTCGAGGTAAAGGTATCCAAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145663.1-753s21c1
Sequence:CCGGGATTCTGCACGTGGATGAAATCTCGAGATTTCATCCACGTGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145663
VALIDATED
DBF4B MISSION shRNA shRNA Plasmid DNA
DBF4 homolog B (S. cerevisiae)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_145663.1-859s1c1
Sequence:CCGGGCAGAGTCAAGAACACGGAAACTCGAGTTTCCGTGTTCTTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145663.1-913s1c1
Sequence:CCGGGAAGATGAAAGCAGGAAGTTTCTCGAGAAACTTCCTGCTTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2608s1c1
Sequence:CCGGGTGACCAAAGTTGGTTCCTTTCTCGAGAAAGGAACCAACTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2556s1c1
Sequence:CCGGCCTGAAGCATTCCACTAAGATCTCGAGATCTTAGTGGAATGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2574s1c1
Sequence:CCGGGATCATCTATTCCAAGGTCATCTCGAGATGACCTTGGAATAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145663.1-1828s21c1
Sequence:CCGGCTCAGACTTGGATACCTTTACCTCGAGGTAAAGGTATCCAAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145663.1-753s21c1
Sequence:CCGGGATTCTGCACGTGGATGAAATCTCGAGATTTCATCCACGTGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145663
VALIDATED
DBF4B MISSION shRNA Lentiviral Transduction Particles
DBF4 homolog B (S. cerevisiae)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_145663.1-859s1c1
Sequence:CCGGGCAGAGTCAAGAACACGGAAACTCGAGTTTCCGTGTTCTTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_145663.1-913s1c1
Sequence:CCGGGAAGATGAAAGCAGGAAGTTTCTCGAGAAACTTCCTGCTTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130557    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2608s1c1
Sequence:CCGGGTGACCAAAGTTGGTTCCTTTCTCGAGAAAGGAACCAACTTTGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130170    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2556s1c1
Sequence:CCGGCCTGAAGCATTCCACTAAGATCTCGAGATCTTAGTGGAATGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129962    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145663.1-2574s1c1
Sequence:CCGGGATCATCTATTCCAAGGTCATCTCGAGATGACCTTGGAATAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145663.1-1828s21c1
Sequence:CCGGCTCAGACTTGGATACCTTTACCTCGAGGTAAAGGTATCCAAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145663.1-753s21c1
Sequence:CCGGGATTCTGCACGTGGATGAAATCTCGAGATTTCATCCACGTGCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks