EMAIL THIS PAGE TO A FRIEND

DBH

dopamine beta-hydroxylase (dopamine beta-monooxygenase)

68 Gene Product Result for
Synonyms: DBM
UniProtKB ID: P09172, Q5T381, Q96AG2
Gene ID:
Human(1621) Summary: The protein encoded by this gene is an oxidoreductase belonging to the copper type II, ascorbate-dependent monooxygenase family. It is present in the synaptic vesicles of postganglionic sympathetic neurons and converts dopamine to norepinephrine. It exists in both soluble and membrane-bound forms, depending on the absence or presence, respectively, of a signal peptide. [provided by RefSeq, Jul 2008]
Mouse(13166) dopamine beta hydroxylase
Rat(25699) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Zebrafish(30505) dopamine beta hydroxylase
cow(280758) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Horse(791247) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
domestic cat(101082957) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
dog(448806) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
chicken(395549) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
sheep(101110668) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
naked mole-rat(101724312) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
domestic guinea pig(100727873) dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
F6513 Fusaric acid from Gibberella fujikuroi human pricing
N1530 Nomifensine maleate salt human pricing
G120 GYKI 52895 solid human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000787 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000787 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000787 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050361 MISSION® esiRNA esiRNA human DBH (esiRNA1) human pricing

Related Products

Product # Description Species Add to Cart
 
AB1585 Anti-Dopamine β Hydroxylase Antibody 50 µL, Detect Dopamine β Hydroxylase using this Anti-Dopamine β Hydroxylase Antibody validated for use in IH, FUNC, RIA & WB. pricing
MAB308 Anti-Dopamine β Hydroxylase Antibody, clone 4F10.2 100 µL, Anti-Dopamine β Hydroxylase Antibody, clone 4F10.2 detects level of Dopamine β Hydroxylase & has been published & validated for use in IH, IH(P) & IF. pricing
AB1536 Anti-Dopamine β Hydroxylase Antibody, CT 100 µL, Anti-Dopamine β Hydroxylase Antibody, C-terminus is an antibody against Dopamine β Hydroxylase for use in IH & WB. pricing
AB1537 Anti-Dopamine β Hydroxylase Antibody, CT 100 µL, This Anti-Dopamine β Hydroxylase Antibody, C-terminus is validated for use in WB, IH for the detection of Dopamine β Hydroxylase. pricing
AB1538 Anti-Dopamine β Hydroxylase Antibody, NT 100 µL, Detect Dopamine β Hydroxylase using this Anti-Dopamine β Hydroxylase Antibody, N-terminus validated for use in IH & WB. pricing
MAB394 Anti-Dopamine β Hydroxylase-SAP Antibody, clone 4F10.2 100 µg, Detect Dopamine β Hydroxylase using this Anti-Dopamine β Hydroxylase-SAP Antibody, clone 4F10.2 validated for use in 0. pricing
MAB394-250UG Anti-Dopamine β Hydroxylase-SAP Antibody, clone 4F10.2 250 µg, Anti-Dopamine β Hydroxylase-SAP Antibody, clone 4F10.2 detects level of Dopamine β Hydroxylase & has been published & validated for use in 0. pricing
MAB394-25UG Anti-Dopamine β Hydroxylase-SAP Antibody, clone 4F10.2 25 µg, This Anti-Dopamine β Hydroxylase-SAP Antibody, clone 4F10.2 is validated for use in 0 for the detection of Dopamine β Hydroxylase. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000787 Rosetta Predictions human pricing
NM_013158 Rosetta Predictions rat pricing
NM_138942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178815 predicted 721
2 SASI_Hs01_00178816 predicted 692
3 SASI_Hs01_00178818 predicted 1046
4 SASI_Hs01_00178819 predicted 1466
5 SASI_Hs01_00178820 predicted 982
6 SASI_Hs01_00178821 predicted 1338
7 SASI_Hs01_00178822 predicted 1385
8 SASI_Hs01_00178823 predicted 1016
9 SASI_Hs01_00178824 predicted 1897
10 SASI_Hs02_00303229 predicted 1302
11 SASI_Hs01_00178817 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052594 predicted 1656
2 SASI_Rn01_00052595 predicted 1548
3 SASI_Rn01_00052596 predicted 778
4 SASI_Rn01_00052597 predicted 1641
5 SASI_Rn01_00052598 predicted 879
6 SASI_Rn01_00052599 predicted 206
7 SASI_Rn01_00052600 predicted 580
8 SASI_Rn01_00052601 predicted 1952
9 SASI_Rn01_00052602 predicted 1097
10 SASI_Rn01_00052603 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339832 predicted 1876
2 SASI_Mm01_00074875 predicted 1559
3 SASI_Mm01_00074876 predicted 1159
4 SASI_Mm02_00339833 predicted 1663
5 SASI_Mm02_00339834 predicted 767
6 SASI_Mm01_00074878 predicted 1478
7 SASI_Mm01_00074879 predicted 755
8 SASI_Mm01_00074881 predicted 200
9 SASI_Mm02_00339835 predicted 1957
10 SASI_Mm01_00074882 predicted 712
11 SASI_Mm01_00074873 predicted 1977
12 SASI_Mm01_00074874 predicted 1675
13 SASI_Mm01_00074877 predicted 1929
14 SASI_Mm01_00074880 predicted 1941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000787
DBH MISSION shRNA Bacterial Glycerol Stock
dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000787.3-1647s21c1
Sequence:CCGGCTTCAACCGCGACGTACTGAACTCGAGTTCAGTACGTCGCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000787.3-2293s21c1
Sequence:CCGGGCGGGTGCCGCTTAAACATTTCTCGAGAAATGTTTAAGCGGCACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000787.2-2455s1c1
Sequence:CCGGCCTGACAACAACTATCACCAACTCGAGTTGGTGATAGTTGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-1557s1c1
Sequence:CCGGCCACCTCATCAACAGGTTCAACTCGAGTTGAACCTGTTGATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-189s1c1
Sequence:CCGGGCTCTCATGGAATGTCAGCTACTCGAGTAGCTGACATTCCATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-700s1c1
Sequence:CCGGTGGTGCTACATTAAGGAGCTTCTCGAGAAGCTCCTTAATGTAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-704s1c1
Sequence:CCGGGCTACATTAAGGAGCTTCCAACTCGAGTTGGAAGCTCCTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000787
DBH MISSION shRNA shRNA Plasmid DNA
dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000787.3-1647s21c1
Sequence:CCGGCTTCAACCGCGACGTACTGAACTCGAGTTCAGTACGTCGCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000787.3-2293s21c1
Sequence:CCGGGCGGGTGCCGCTTAAACATTTCTCGAGAAATGTTTAAGCGGCACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000787.2-2455s1c1
Sequence:CCGGCCTGACAACAACTATCACCAACTCGAGTTGGTGATAGTTGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-1557s1c1
Sequence:CCGGCCACCTCATCAACAGGTTCAACTCGAGTTGAACCTGTTGATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-189s1c1
Sequence:CCGGGCTCTCATGGAATGTCAGCTACTCGAGTAGCTGACATTCCATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-700s1c1
Sequence:CCGGTGGTGCTACATTAAGGAGCTTCTCGAGAAGCTCCTTAATGTAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-704s1c1
Sequence:CCGGGCTACATTAAGGAGCTTCCAACTCGAGTTGGAAGCTCCTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000787
DBH MISSION shRNA Lentiviral Transduction Particles
dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000787.3-1647s21c1
Sequence:CCGGCTTCAACCGCGACGTACTGAACTCGAGTTCAGTACGTCGCGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000787.3-2293s21c1
Sequence:CCGGGCGGGTGCCGCTTAAACATTTCTCGAGAAATGTTTAAGCGGCACCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000787.2-2455s1c1
Sequence:CCGGCCTGACAACAACTATCACCAACTCGAGTTGGTGATAGTTGTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-1557s1c1
Sequence:CCGGCCACCTCATCAACAGGTTCAACTCGAGTTGAACCTGTTGATGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-189s1c1
Sequence:CCGGGCTCTCATGGAATGTCAGCTACTCGAGTAGCTGACATTCCATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-700s1c1
Sequence:CCGGTGGTGCTACATTAAGGAGCTTCTCGAGAAGCTCCTTAATGTAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000787.2-704s1c1
Sequence:CCGGGCTACATTAAGGAGCTTCCAACTCGAGTTGGAAGCTCCTTAATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138942
DBH MISSION shRNA Bacterial Glycerol Stock
dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138942.3-1653s21c1
Sequence:CCGGGAACTCTTTCAATCGGGATATCTCGAGATATCCCGATTGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138942.3-2067s21c1
Sequence:CCGGCGGAGAAGCCCTGGACATTATCTCGAGATAATGTCCAGGGCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138942.3-1223s21c1
Sequence:CCGGACTCCGGAATCCACATCTTTGCTCGAGCAAAGATGTGGATTCCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1023s1c1
Sequence:CCGGCGACACCACATCATCATGTATCTCGAGATACATGATGATGTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-921s1c1
Sequence:CCGGGAGGATGTACAAACCATGGATCTCGAGATCCATGGTTTGTACATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1682s1c1
Sequence:CCGGCATCACTTCATGCACATACAACTCGAGTTGTATGTGCATGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1928s1c1
Sequence:CCGGGAACTCTTTCAATCGGAATATCTCGAGATATTCCGATTGAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-794s1c1
Sequence:CCGGCCATCTAGTGTATGGGATCTTCTCGAGAAGATCCCATACACTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138942
DBH MISSION shRNA shRNA Plasmid DNA
dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138942.3-1653s21c1
Sequence:CCGGGAACTCTTTCAATCGGGATATCTCGAGATATCCCGATTGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138942.3-2067s21c1
Sequence:CCGGCGGAGAAGCCCTGGACATTATCTCGAGATAATGTCCAGGGCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138942.3-1223s21c1
Sequence:CCGGACTCCGGAATCCACATCTTTGCTCGAGCAAAGATGTGGATTCCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1023s1c1
Sequence:CCGGCGACACCACATCATCATGTATCTCGAGATACATGATGATGTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-921s1c1
Sequence:CCGGGAGGATGTACAAACCATGGATCTCGAGATCCATGGTTTGTACATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1682s1c1
Sequence:CCGGCATCACTTCATGCACATACAACTCGAGTTGTATGTGCATGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1928s1c1
Sequence:CCGGGAACTCTTTCAATCGGAATATCTCGAGATATTCCGATTGAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-794s1c1
Sequence:CCGGCCATCTAGTGTATGGGATCTTCTCGAGAAGATCCCATACACTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138942
DBH MISSION shRNA Lentiviral Transduction Particles
dopamine beta-hydroxylase (dopamine beta-monooxygenase)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138942.3-1653s21c1
Sequence:CCGGGAACTCTTTCAATCGGGATATCTCGAGATATCCCGATTGAAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138942.3-2067s21c1
Sequence:CCGGCGGAGAAGCCCTGGACATTATCTCGAGATAATGTCCAGGGCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138942.3-1223s21c1
Sequence:CCGGACTCCGGAATCCACATCTTTGCTCGAGCAAAGATGTGGATTCCGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1023s1c1
Sequence:CCGGCGACACCACATCATCATGTATCTCGAGATACATGATGATGTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-921s1c1
Sequence:CCGGGAGGATGTACAAACCATGGATCTCGAGATCCATGGTTTGTACATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1682s1c1
Sequence:CCGGCATCACTTCATGCACATACAACTCGAGTTGTATGTGCATGAAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-1928s1c1
Sequence:CCGGGAACTCTTTCAATCGGAATATCTCGAGATATTCCGATTGAAAGAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138942.2-794s1c1
Sequence:CCGGCCATCTAGTGTATGGGATCTTCTCGAGAAGATCCCATACACTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks