EMAIL THIS PAGE TO A FRIEND

DBI

diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)

Synonyms: ACBD1 ACBP CCK-RP EP
Gene ID:
Human(1622) Summary: This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(13167) diazepam binding inhibitor
Rat(25045) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Zebrafish(393831) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
chicken(395263) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
domestic cat(101082679) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
cow(768330) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Horse(100049822) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
dog(476115) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
fruit fly(38784) Diazepam-binding inhibitor
domestic guinea pig(100713514) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
naked mole-rat(101705205) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
sheep(101111606) diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020548 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020548 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020548 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079862 Rosetta Predictions human pricing
NM_001079863 Rosetta Predictions human pricing
NM_020548 Rosetta Predictions human pricing
NM_031853 Rosetta Predictions rat pricing
NM_001037999 Rosetta Predictions mouse pricing
NM_007830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313950 predicted 250
2 SASI_Hs02_00313951 predicted 200
3 SASI_Hs02_00313952 predicted 253
4 SASI_Hs02_00313953 predicted 376
5 SASI_Hs02_00313954 predicted 379
6 SASI_Hs02_00313955 predicted 378
7 SASI_Hs02_00313956 predicted 328
8 SASI_Hs02_00313957 predicted 276
9 SASI_Hs02_00313958 predicted 343
10 SASI_Hs02_00313959 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313960 predicted 325
2 SASI_Hs02_00313961 predicted 509
3 SASI_Hs02_00313962 predicted 502
4 SASI_Hs02_00313963 predicted 505
5 SASI_Hs02_00313964 predicted 452
6 SASI_Hs02_00313965 predicted 455
7 SASI_Hs02_00313966 predicted 348
8 SASI_Hs02_00313967 predicted 499
9 SASI_Hs02_00313968 predicted 286
10 SASI_Hs02_00313969 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020548 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224283 predicted 333
2 SASI_Hs01_00224284 predicted 524
3 SASI_Hs02_00353589 predicted 512
4 SASI_Hs01_00224286 predicted 517
5 SASI_Hs01_00224287 predicted 465
6 SASI_Hs02_00353590 predicted 470
7 SASI_Hs01_00224288 predicted 364
8 SASI_Hs02_00353591 predicted 507
9 SASI_Hs01_00224289 predicted 300
10 SASI_Hs01_00224291 predicted 357
11 SASI_Hs01_00224285 predicted 465
12 SASI_Hs01_00224290 predicted 438
13 SASI_Hs01_00224292 predicted 283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062263 predicted 215
2 SASI_Rn01_00062264 predicted 217
3 SASI_Rn01_00062265 predicted 211
4 SASI_Rn01_00062266 predicted 214
5 SASI_Rn01_00062267 predicted 219
6 SASI_Rn01_00062268 predicted 221
7 SASI_Rn01_00062269 predicted 219
8 SASI_Rn01_00062270 predicted 215
9 SASI_Rn01_00062271 predicted 296
10 SASI_Rn01_00062272 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037999 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027983 predicted 255
2 SASI_Mm01_00027984 predicted 251
3 SASI_Mm01_00027985 predicted 221
4 SASI_Mm01_00027986 predicted 204
5 SASI_Mm02_00289577 predicted 352
6 SASI_Mm01_00027987 predicted 315
7 SASI_Mm01_00027988 predicted 214
8 SASI_Mm01_00027990 predicted 281
9 SASI_Mm01_00027991 predicted 251
10 SASI_Mm01_00027992 predicted 225
11 SASI_Mm01_00027989 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075684 predicted 229
2 SASI_Mm02_00312566 predicted 196
3 SASI_Mm01_00075685 predicted 221
4 SASI_Mm01_00075686 predicted 288
5 SASI_Mm01_00075687 predicted 260
6 SASI_Mm01_00075688 predicted 225
7 SASI_Mm01_00075689 predicted 206
8 SASI_Mm01_00075690 predicted 294
9 SASI_Mm01_00075691 predicted 298
10 SASI_Mm01_00075692 predicted 235
11 SASI_Mm01_00075683 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007830
VALIDATED
DBI MISSION shRNA Bacterial Glycerol Stock
diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-188s1c1
Sequence:CCGGGCTGTTCATCTACAGTCACTTCTCGAGAAGTGACTGTAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-222s1c1
Sequence:CCGGGTGGGCGATGTAAATACAGATCTCGAGATCTGTATTTACATCGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-282s1c1
Sequence:CCGGGACTCGTGGAACAAGCTGAAACTCGAGTTTCAGCTTGTTCCACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007830.2-353s1c1
Sequence:CCGGGCTAAAGAAGAAATACGGAATCTCGAGATTCCGTATTTCTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-159s1c1
Sequence:CCGGCTCAAGACTCAGCCAACTGATCTCGAGATCAGTTGGCTGAGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-272s21c1
Sequence:CCGGACCTCAAGGGCAAAGCCAAGTCTCGAGACTTGGCTTTGCCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-295s21c1
Sequence:CCGGGACTCGTGGAACAAGCTGAAACTCGAGTTTCAGCTTGTTCCACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-201s21c1
Sequence:CCGGGCTGTTCATCTACAGTCACTTCTCGAGAAGTGACTGTAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-172s21c1
Sequence:CCGGCTCAAGACTCAGCCAACTGATCTCGAGATCAGTTGGCTGAGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-331s21c1
Sequence:CCGGAGTGCCATGAAGACCTATGTGCTCGAGCACATAGGTCTTCATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007830
VALIDATED
DBI MISSION shRNA shRNA Plasmid DNA
diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-188s1c1
Sequence:CCGGGCTGTTCATCTACAGTCACTTCTCGAGAAGTGACTGTAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-222s1c1
Sequence:CCGGGTGGGCGATGTAAATACAGATCTCGAGATCTGTATTTACATCGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-282s1c1
Sequence:CCGGGACTCGTGGAACAAGCTGAAACTCGAGTTTCAGCTTGTTCCACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007830.2-353s1c1
Sequence:CCGGGCTAAAGAAGAAATACGGAATCTCGAGATTCCGTATTTCTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-159s1c1
Sequence:CCGGCTCAAGACTCAGCCAACTGATCTCGAGATCAGTTGGCTGAGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-272s21c1
Sequence:CCGGACCTCAAGGGCAAAGCCAAGTCTCGAGACTTGGCTTTGCCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-295s21c1
Sequence:CCGGGACTCGTGGAACAAGCTGAAACTCGAGTTTCAGCTTGTTCCACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-201s21c1
Sequence:CCGGGCTGTTCATCTACAGTCACTTCTCGAGAAGTGACTGTAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-172s21c1
Sequence:CCGGCTCAAGACTCAGCCAACTGATCTCGAGATCAGTTGGCTGAGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-331s21c1
Sequence:CCGGAGTGCCATGAAGACCTATGTGCTCGAGCACATAGGTCTTCATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007830
VALIDATED
DBI MISSION shRNA Lentiviral Transduction Particles
diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-188s1c1
Sequence:CCGGGCTGTTCATCTACAGTCACTTCTCGAGAAGTGACTGTAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-222s1c1
Sequence:CCGGGTGGGCGATGTAAATACAGATCTCGAGATCTGTATTTACATCGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-282s1c1
Sequence:CCGGGACTCGTGGAACAAGCTGAAACTCGAGTTTCAGCTTGTTCCACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007830.2-353s1c1
Sequence:CCGGGCTAAAGAAGAAATACGGAATCTCGAGATTCCGTATTTCTTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007830.2-159s1c1
Sequence:CCGGCTCAAGACTCAGCCAACTGATCTCGAGATCAGTTGGCTGAGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-272s21c1
Sequence:CCGGACCTCAAGGGCAAAGCCAAGTCTCGAGACTTGGCTTTGCCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-295s21c1
Sequence:CCGGGACTCGTGGAACAAGCTGAAACTCGAGTTTCAGCTTGTTCCACGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-201s21c1
Sequence:CCGGGCTGTTCATCTACAGTCACTTCTCGAGAAGTGACTGTAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-172s21c1
Sequence:CCGGCTCAAGACTCAGCCAACTGATCTCGAGATCAGTTGGCTGAGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007830.3-331s21c1
Sequence:CCGGAGTGCCATGAAGACCTATGTGCTCGAGCACATAGGTCTTCATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020548
VALIDATED
DBI MISSION shRNA Bacterial Glycerol Stock
diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-145s1c1
Sequence:CCGGGCTGTTCATCTATGGCCACTACTCGAGTAGTGGCCATAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-100s1c1
Sequence:CCGGAGAGGAGGTTAGGCACCTTAACTCGAGTTAAGGTGCCTAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-277s1c1
Sequence:CCGGTGCCATGAAAGCTTACATCAACTCGAGTTGATGTAAGCTTTCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-179s1c1
Sequence:CCGGGTGGGCGACATAAATACAGAACTCGAGTTCTGTATTTATGTCGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020548.2-294s1c1
Sequence:CCGGTCAACAAAGTAGAAGAGCTAACTCGAGTTAGCTCTTCTACTTTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-517s21c1
Sequence:CCGGCGGGATATGAGAGACTGGATTCTCGAGAATCCAGTCTCTCATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-292s21c1
Sequence:CCGGAGAGGAGGTTAGGCACCTTAACTCGAGTTAAGGTGCCTAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-337s21c1
Sequence:CCGGGCTGTTCATCTATGGCCACTACTCGAGTAGTGGCCATAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-469s21c1
Sequence:CCGGTGCCATGAAAGCTTACATCAACTCGAGTTGATGTAAGCTTTCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020548.5-539s21c1
Sequence:CCGGGGTTACTGTGCCATGTGTTTACTCGAGTAAACACATGGCACAGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020548
VALIDATED
DBI MISSION shRNA shRNA Plasmid DNA
diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-145s1c1
Sequence:CCGGGCTGTTCATCTATGGCCACTACTCGAGTAGTGGCCATAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-100s1c1
Sequence:CCGGAGAGGAGGTTAGGCACCTTAACTCGAGTTAAGGTGCCTAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-277s1c1
Sequence:CCGGTGCCATGAAAGCTTACATCAACTCGAGTTGATGTAAGCTTTCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-179s1c1
Sequence:CCGGGTGGGCGACATAAATACAGAACTCGAGTTCTGTATTTATGTCGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020548.2-294s1c1
Sequence:CCGGTCAACAAAGTAGAAGAGCTAACTCGAGTTAGCTCTTCTACTTTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-517s21c1
Sequence:CCGGCGGGATATGAGAGACTGGATTCTCGAGAATCCAGTCTCTCATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-292s21c1
Sequence:CCGGAGAGGAGGTTAGGCACCTTAACTCGAGTTAAGGTGCCTAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-337s21c1
Sequence:CCGGGCTGTTCATCTATGGCCACTACTCGAGTAGTGGCCATAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-469s21c1
Sequence:CCGGTGCCATGAAAGCTTACATCAACTCGAGTTGATGTAAGCTTTCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020548.5-539s21c1
Sequence:CCGGGGTTACTGTGCCATGTGTTTACTCGAGTAAACACATGGCACAGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020548
VALIDATED
DBI MISSION shRNA Lentiviral Transduction Particles
diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-145s1c1
Sequence:CCGGGCTGTTCATCTATGGCCACTACTCGAGTAGTGGCCATAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-100s1c1
Sequence:CCGGAGAGGAGGTTAGGCACCTTAACTCGAGTTAAGGTGCCTAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-277s1c1
Sequence:CCGGTGCCATGAAAGCTTACATCAACTCGAGTTGATGTAAGCTTTCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020548.2-179s1c1
Sequence:CCGGGTGGGCGACATAAATACAGAACTCGAGTTCTGTATTTATGTCGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020548.2-294s1c1
Sequence:CCGGTCAACAAAGTAGAAGAGCTAACTCGAGTTAGCTCTTCTACTTTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-517s21c1
Sequence:CCGGCGGGATATGAGAGACTGGATTCTCGAGAATCCAGTCTCTCATATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-292s21c1
Sequence:CCGGAGAGGAGGTTAGGCACCTTAACTCGAGTTAAGGTGCCTAACCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-337s21c1
Sequence:CCGGGCTGTTCATCTATGGCCACTACTCGAGTAGTGGCCATAGATGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_020548.5-469s21c1
Sequence:CCGGTGCCATGAAAGCTTACATCAACTCGAGTTGATGTAAGCTTTCATGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020548.5-539s21c1
Sequence:CCGGGGTTACTGTGCCATGTGTTTACTCGAGTAAACACATGGCACAGTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks