EMAIL THIS PAGE TO A FRIEND

DBN1

drebrin 1

Synonyms: D0S117E
UniProtKB ID: Q16643, B2RBG0, Q9UFZ5
Gene ID:
Human(1627) Summary: The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(56320) drebrin 1
Rat(81653) drebrin 1
sheep(101123207) drebrin 1
chicken(396496) drebrin 1
dog(489088) drebrin 1
Horse(100068529) drebrin 1
cow(505406) drebrin 1
Gene Class: Cytoskeleton
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004395 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004395 Rosetta Predictions human pricing
NM_080881 Rosetta Predictions human pricing
NM_031024 Rosetta Predictions rat pricing
NM_019813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164366 predicted 932
2 SASI_Hs01_00164367 predicted 2323
3 SASI_Hs01_00164368 predicted 878
4 SASI_Hs01_00164369 predicted 920
5 SASI_Hs01_00164371 predicted 1982
6 SASI_Hs01_00164373 predicted 2359
7 SASI_Hs01_00164374 predicted 1029
8 SASI_Hs01_00164375 predicted 2402
9 SASI_Hs02_00337512 predicted 1218
10 SASI_Hs02_00337513 predicted 2406
11 SASI_Hs01_00164370 predicted 666
12 SASI_Hs01_00164372 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079200 predicted 1045
2 SASI_Hs01_00079201 predicted 2433
3 SASI_Hs01_00079202 predicted 992
4 SASI_Hs01_00079203 predicted 1035
5 SASI_Hs01_00079205 predicted 2099
6 SASI_Hs01_00079207 predicted 2471
7 SASI_Hs01_00079208 predicted 1142
8 SASI_Hs01_00079209 predicted 2512
9 SASI_Hs02_00362679 predicted 1337
10 SASI_Hs02_00362680 predicted 2526
11 SASI_Hs01_00079204 predicted 1137
12 SASI_Hs01_00079206 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031024 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077003 predicted 569
2 SASI_Rn01_00077004 predicted 402
3 SASI_Rn02_00264222 predicted 573
4 SASI_Rn01_00077007 predicted 1785
5 SASI_Rn01_00077008 predicted 2028
6 SASI_Rn01_00077009 predicted 805
7 SASI_Rn01_00077010 predicted 1568
8 SASI_Rn02_00264223 predicted 2026
9 SASI_Rn01_00077011 predicted 210
10 SASI_Rn01_00077012 predicted 1901
11 SASI_Rn01_00077005 predicted 232
12 SASI_Rn01_00077006 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124369 predicted 596
2 SASI_Mm01_00124370 predicted 592
3 SASI_Mm01_00124372 predicted 930
4 SASI_Mm01_00124373 predicted 1672
5 SASI_Mm01_00124374 predicted 442
6 SASI_Mm01_00124375 predicted 1478
7 SASI_Mm01_00124376 predicted 1884
8 SASI_Mm01_00124377 predicted 816
9 SASI_Mm01_00124378 predicted 1949
10 SASI_Mm02_00325085 predicted 586
11 SASI_Mm01_00124371 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019813
VALIDATED
DBN1 MISSION shRNA Bacterial Glycerol Stock
drebrin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019813.2-2331s1c1
Sequence:CCGGCCCAGACCAGATTGTAGCTTACTCGAGTAAGCTACAATCTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-1851s1c1
Sequence:CCGGCCAATGGAGAGACCACTCAAACTCGAGTTTGAGTGGTCTCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-251s1c1
Sequence:CCGGGAGAACCAGAAAGTGATGTATCTCGAGATACATCACTTTCTGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019813.2-1522s1c1
Sequence:CCGGCATTGATCTATGGCCTGGCAACTCGAGTTGCCAGGCCATAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-835s1c1
Sequence:CCGGGCAGTCTATCTTTGGTGACCACTCGAGTGGTCACCAAAGATAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019813.3-2331s21c1
Sequence:CCGGCCCAGACCAGATTGTAGCTTACTCGAGTAAGCTACAATCTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-1851s21c1
Sequence:CCGGCCAATGGAGAGACCACTCAAACTCGAGTTTGAGTGGTCTCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-835s21c1
Sequence:CCGGGCAGTCTATCTTTGGTGACCACTCGAGTGGTCACCAAAGATAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-251s21c1
Sequence:CCGGGAGAACCAGAAAGTGATGTATCTCGAGATACATCACTTTCTGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019813
VALIDATED
DBN1 MISSION shRNA shRNA Plasmid DNA
drebrin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019813.2-2331s1c1
Sequence:CCGGCCCAGACCAGATTGTAGCTTACTCGAGTAAGCTACAATCTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-1851s1c1
Sequence:CCGGCCAATGGAGAGACCACTCAAACTCGAGTTTGAGTGGTCTCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-251s1c1
Sequence:CCGGGAGAACCAGAAAGTGATGTATCTCGAGATACATCACTTTCTGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019813.2-1522s1c1
Sequence:CCGGCATTGATCTATGGCCTGGCAACTCGAGTTGCCAGGCCATAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-835s1c1
Sequence:CCGGGCAGTCTATCTTTGGTGACCACTCGAGTGGTCACCAAAGATAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019813.3-2331s21c1
Sequence:CCGGCCCAGACCAGATTGTAGCTTACTCGAGTAAGCTACAATCTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-1851s21c1
Sequence:CCGGCCAATGGAGAGACCACTCAAACTCGAGTTTGAGTGGTCTCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-835s21c1
Sequence:CCGGGCAGTCTATCTTTGGTGACCACTCGAGTGGTCACCAAAGATAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-251s21c1
Sequence:CCGGGAGAACCAGAAAGTGATGTATCTCGAGATACATCACTTTCTGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019813
VALIDATED
DBN1 MISSION shRNA Lentiviral Transduction Particles
drebrin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019813.2-2331s1c1
Sequence:CCGGCCCAGACCAGATTGTAGCTTACTCGAGTAAGCTACAATCTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-1851s1c1
Sequence:CCGGCCAATGGAGAGACCACTCAAACTCGAGTTTGAGTGGTCTCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-251s1c1
Sequence:CCGGGAGAACCAGAAAGTGATGTATCTCGAGATACATCACTTTCTGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019813.2-1522s1c1
Sequence:CCGGCATTGATCTATGGCCTGGCAACTCGAGTTGCCAGGCCATAGATCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019813.2-835s1c1
Sequence:CCGGGCAGTCTATCTTTGGTGACCACTCGAGTGGTCACCAAAGATAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019813.3-2331s21c1
Sequence:CCGGCCCAGACCAGATTGTAGCTTACTCGAGTAAGCTACAATCTGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-1851s21c1
Sequence:CCGGCCAATGGAGAGACCACTCAAACTCGAGTTTGAGTGGTCTCTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-835s21c1
Sequence:CCGGGCAGTCTATCTTTGGTGACCACTCGAGTGGTCACCAAAGATAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019813.3-251s21c1
Sequence:CCGGGAGAACCAGAAAGTGATGTATCTCGAGATACATCACTTTCTGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004395
VALIDATED
DBN1 MISSION shRNA Bacterial Glycerol Stock
drebrin 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-903s1c1
Sequence:CCGGCAGTCTATCTTTGGTGACCATCTCGAGATGGTCACCAAAGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004395.2-649s1c1
Sequence:CCGGCTGTGGAAATGAAGCGGATTACTCGAGTAATCCGCTTCATTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-1998s1c1
Sequence:CCGGCCTGTGTTCTACAACAAGCCTCTCGAGAGGCTTGTTGTAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-1941s1c1
Sequence:CCGGCAATCACAGGAGGAGGAGTTTCTCGAGAAACTCCTCCTCCTGTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-231s1c1
Sequence:CCGGGCTCTGTACACATATGAAGATCTCGAGATCTTCATATGTGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1752s21c1
Sequence:CCGGGTGCCACCCTTCTCAACTTTGCTCGAGCAAAGTTGAGAAGGGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-889s21c1
Sequence:CCGGGCAGACTTTAGAAGCGGAAGACTCGAGTCTTCCGCTTCTAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2360s21c1
Sequence:CCGGAGTTGAGACGCTGTTGCAAATCTCGAGATTTGCAACAGCGTCTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1420s21c1
Sequence:CCGGCCCTGCAGAGGACTTGATGTTCTCGAGAACATCAAGTCCTCTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1096s21c1
Sequence:CCGGTGATGTACCCTCGCCCTTCAACTCGAGTTGAAGGGCGAGGGTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-327s21c1
Sequence:CCGGAGGAGCTTTCGGGACACTTTGCTCGAGCAAAGTGTCCCGAAAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2328s21c1
Sequence:CCGGTTGTACAGTTGACTGGCTTTCCTCGAGGAAAGCCAGTCAACTGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2398s21c1
Sequence:CCGGGGTCCAGATTGTAGCTCTTAGCTCGAGCTAAGAGCTACAATCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1589s21c1
Sequence:CCGGACCAGCCTCATTGACCTATGGCTCGAGCCATAGGTCAATGAGGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-291s21c1
Sequence:CCGGACCTCAAGCTTGCAGCATCAGCTCGAGCTGATGCTGCAAGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-419s21c1
Sequence:CCGGATCAACTGGGTGGGCGAAGATCTCGAGATCTTCGCCCACCCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004395
VALIDATED
DBN1 MISSION shRNA shRNA Plasmid DNA
drebrin 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-903s1c1
Sequence:CCGGCAGTCTATCTTTGGTGACCATCTCGAGATGGTCACCAAAGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004395.2-649s1c1
Sequence:CCGGCTGTGGAAATGAAGCGGATTACTCGAGTAATCCGCTTCATTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-1998s1c1
Sequence:CCGGCCTGTGTTCTACAACAAGCCTCTCGAGAGGCTTGTTGTAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-1941s1c1
Sequence:CCGGCAATCACAGGAGGAGGAGTTTCTCGAGAAACTCCTCCTCCTGTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-231s1c1
Sequence:CCGGGCTCTGTACACATATGAAGATCTCGAGATCTTCATATGTGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1752s21c1
Sequence:CCGGGTGCCACCCTTCTCAACTTTGCTCGAGCAAAGTTGAGAAGGGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-889s21c1
Sequence:CCGGGCAGACTTTAGAAGCGGAAGACTCGAGTCTTCCGCTTCTAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2360s21c1
Sequence:CCGGAGTTGAGACGCTGTTGCAAATCTCGAGATTTGCAACAGCGTCTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1420s21c1
Sequence:CCGGCCCTGCAGAGGACTTGATGTTCTCGAGAACATCAAGTCCTCTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1096s21c1
Sequence:CCGGTGATGTACCCTCGCCCTTCAACTCGAGTTGAAGGGCGAGGGTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-327s21c1
Sequence:CCGGAGGAGCTTTCGGGACACTTTGCTCGAGCAAAGTGTCCCGAAAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2328s21c1
Sequence:CCGGTTGTACAGTTGACTGGCTTTCCTCGAGGAAAGCCAGTCAACTGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2398s21c1
Sequence:CCGGGGTCCAGATTGTAGCTCTTAGCTCGAGCTAAGAGCTACAATCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1589s21c1
Sequence:CCGGACCAGCCTCATTGACCTATGGCTCGAGCCATAGGTCAATGAGGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-291s21c1
Sequence:CCGGACCTCAAGCTTGCAGCATCAGCTCGAGCTGATGCTGCAAGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-419s21c1
Sequence:CCGGATCAACTGGGTGGGCGAAGATCTCGAGATCTTCGCCCACCCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004395
VALIDATED
DBN1 MISSION shRNA Lentiviral Transduction Particles
drebrin 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-903s1c1
Sequence:CCGGCAGTCTATCTTTGGTGACCATCTCGAGATGGTCACCAAAGATAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_004395.2-649s1c1
Sequence:CCGGCTGTGGAAATGAAGCGGATTACTCGAGTAATCCGCTTCATTTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-1998s1c1
Sequence:CCGGCCTGTGTTCTACAACAAGCCTCTCGAGAGGCTTGTTGTAGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-1941s1c1
Sequence:CCGGCAATCACAGGAGGAGGAGTTTCTCGAGAAACTCCTCCTCCTGTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004395.2-231s1c1
Sequence:CCGGGCTCTGTACACATATGAAGATCTCGAGATCTTCATATGTGTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1752s21c1
Sequence:CCGGGTGCCACCCTTCTCAACTTTGCTCGAGCAAAGTTGAGAAGGGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-889s21c1
Sequence:CCGGGCAGACTTTAGAAGCGGAAGACTCGAGTCTTCCGCTTCTAAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426856    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2360s21c1
Sequence:CCGGAGTTGAGACGCTGTTGCAAATCTCGAGATTTGCAACAGCGTCTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1420s21c1
Sequence:CCGGCCCTGCAGAGGACTTGATGTTCTCGAGAACATCAAGTCCTCTGCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1096s21c1
Sequence:CCGGTGATGTACCCTCGCCCTTCAACTCGAGTTGAAGGGCGAGGGTACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-327s21c1
Sequence:CCGGAGGAGCTTTCGGGACACTTTGCTCGAGCAAAGTGTCCCGAAAGCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2328s21c1
Sequence:CCGGTTGTACAGTTGACTGGCTTTCCTCGAGGAAAGCCAGTCAACTGTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004395.3-2398s21c1
Sequence:CCGGGGTCCAGATTGTAGCTCTTAGCTCGAGCTAAGAGCTACAATCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-1589s21c1
Sequence:CCGGACCAGCCTCATTGACCTATGGCTCGAGCCATAGGTCAATGAGGCTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-291s21c1
Sequence:CCGGACCTCAAGCTTGCAGCATCAGCTCGAGCTGATGCTGCAAGCTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004395.3-419s21c1
Sequence:CCGGATCAACTGGGTGGGCGAAGATCTCGAGATCTTCGCCCACCCAGTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks