EMAIL THIS PAGE TO A FRIEND

DBNDD1

dysbindin (dystrobrevin binding protein 1) domain containing 1

62 Gene Product Result for
UniProtKB ID: Q9H9R9, B4DQS3, Q69YT2, Q9BW25
Gene ID:
Mouse(72185) dysbindin (dystrobrevin binding protein 1) domain containing 1
Rat(361437) dysbindin (dystrobrevin binding protein 1) domain containing 1
chicken(415857) dysbindin (dystrobrevin binding protein 1) domain containing 1
cow(518157) dysbindin (dystrobrevin binding protein 1) domain containing 1
domestic cat(101084246) dysbindin (dystrobrevin binding protein 1) domain containing 1
dog(489649) dysbindin (dystrobrevin binding protein 1) domain containing 1
naked mole-rat(101724859) dysbindin (dystrobrevin binding protein 1) domain containing 1
domestic guinea pig(100733731) dysbindin (dystrobrevin binding protein 1) domain containing 1
sheep(101108508) dysbindin (dystrobrevin binding protein 1) domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042610 Rosetta Predictions human pricing
NM_024043 Rosetta Predictions human pricing
NM_001014156 Rosetta Predictions rat pricing
NM_028146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310798 predicted 935
2 SASI_Hs02_00310799 predicted 1159
3 SASI_Hs02_00310800 predicted 1110
4 SASI_Hs02_00310801 predicted 607
5 SASI_Hs02_00310802 predicted 1703
6 SASI_Hs02_00310803 predicted 1631
7 SASI_Hs02_00310804 predicted 1349
8 SASI_Hs02_00310805 predicted 1640
9 SASI_Hs02_00310806 predicted 1666
10 SASI_Hs02_00310807 predicted 1688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224676 predicted 882
2 SASI_Hs01_00224677 predicted 1108
3 SASI_Hs02_00356478 predicted 1059
4 SASI_Hs01_00224678 predicted 554
5 SASI_Hs01_00224679 predicted 149
6 SASI_Hs02_00356479 predicted 1078
7 SASI_Hs02_00356480 predicted 76
8 SASI_Hs02_00356481 predicted 643
9 SASI_Hs02_00356482 predicted 790
10 SASI_Hs02_00356483 predicted 653
11 SASI_Hs01_00224680 predicted 1649
12 SASI_Hs01_00224681 predicted 1577
13 SASI_Hs01_00224682 predicted 1305
14 SASI_Hs01_00224683 predicted 1282
15 SASI_Hs01_00224684 predicted 1591
16 SASI_Hs01_00224685 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085316 predicted 757
2 SASI_Rn01_00085317 predicted 888
3 SASI_Rn01_00085318 predicted 950
4 SASI_Rn01_00085319 predicted 1008
5 SASI_Rn02_00201642 predicted 1011
6 SASI_Rn01_00085320 predicted 949
7 SASI_Rn01_00085321 predicted 1021
8 SASI_Rn01_00085322 predicted 1160
9 SASI_Rn01_00085323 predicted 954
10 SASI_Rn01_00085324 predicted 1110
11 SASI_Rn01_00085315 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072334 predicted 438
2 SASI_Mm01_00072335 predicted 772
3 SASI_Mm01_00072336 predicted 516
4 SASI_Mm01_00072337 predicted 1065
5 SASI_Mm01_00072338 predicted 1041
6 SASI_Mm01_00072339 predicted 613
7 SASI_Mm01_00072340 predicted 609
8 SASI_Mm01_00072342 predicted 360
9 SASI_Mm01_00072343 predicted 829
10 SASI_Mm02_00333412 predicted 1059
11 SASI_Mm01_00072341 predicted 1059
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024043
DBNDD1 MISSION shRNA Bacterial Glycerol Stock
dysbindin (dystrobrevin binding protein 1) domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024043.2-101s21c1
Sequence:CCGGCTCAACTGTGAGGCATGGTTGCTCGAGCAACCATGCCTCACAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024043.2-951s21c1
Sequence:CCGGGAACGTGCTGAGGAATGGAGTCTCGAGACTCCATTCCTCAGCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024043.2-1924s1c1
Sequence:CCGGGCTTTCTCTTTCAGTCCCATACTCGAGTATGGGACTGAAAGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-500s1c1
Sequence:CCGGGACGAGGACAAGGGCTGAGCACTCGAGTGCTCAGCCCTTGTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-574s1c1
Sequence:CCGGACACGTTTCTCACTGTGGAGACTCGAGTCTCCACAGTGAGAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-401s1c1
Sequence:CCGGCGAGGTCTTTGCTGACTCGGACTCGAGTCCGAGTCAGCAAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-167s1c1
Sequence:CCGGGATCGTTAAGGAGGCTGAGGTCTCGAGACCTCAGCCTCCTTAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024043
DBNDD1 MISSION shRNA shRNA Plasmid DNA
dysbindin (dystrobrevin binding protein 1) domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024043.2-101s21c1
Sequence:CCGGCTCAACTGTGAGGCATGGTTGCTCGAGCAACCATGCCTCACAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024043.2-951s21c1
Sequence:CCGGGAACGTGCTGAGGAATGGAGTCTCGAGACTCCATTCCTCAGCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024043.2-1924s1c1
Sequence:CCGGGCTTTCTCTTTCAGTCCCATACTCGAGTATGGGACTGAAAGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-500s1c1
Sequence:CCGGGACGAGGACAAGGGCTGAGCACTCGAGTGCTCAGCCCTTGTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-574s1c1
Sequence:CCGGACACGTTTCTCACTGTGGAGACTCGAGTCTCCACAGTGAGAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-401s1c1
Sequence:CCGGCGAGGTCTTTGCTGACTCGGACTCGAGTCCGAGTCAGCAAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-167s1c1
Sequence:CCGGGATCGTTAAGGAGGCTGAGGTCTCGAGACCTCAGCCTCCTTAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024043
DBNDD1 MISSION shRNA Lentiviral Transduction Particles
dysbindin (dystrobrevin binding protein 1) domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024043.2-101s21c1
Sequence:CCGGCTCAACTGTGAGGCATGGTTGCTCGAGCAACCATGCCTCACAGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024043.2-951s21c1
Sequence:CCGGGAACGTGCTGAGGAATGGAGTCTCGAGACTCCATTCCTCAGCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024043.2-1924s1c1
Sequence:CCGGGCTTTCTCTTTCAGTCCCATACTCGAGTATGGGACTGAAAGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-500s1c1
Sequence:CCGGGACGAGGACAAGGGCTGAGCACTCGAGTGCTCAGCCCTTGTCCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-574s1c1
Sequence:CCGGACACGTTTCTCACTGTGGAGACTCGAGTCTCCACAGTGAGAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-401s1c1
Sequence:CCGGCGAGGTCTTTGCTGACTCGGACTCGAGTCCGAGTCAGCAAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024043.2-167s1c1
Sequence:CCGGGATCGTTAAGGAGGCTGAGGTCTCGAGACCTCAGCCTCCTTAACGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028146
DBNDD1 MISSION shRNA Bacterial Glycerol Stock
dysbindin (dystrobrevin binding protein 1) domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-997s1c1
Sequence:CCGGGTACATTTGGTGGCAGGTCAACTCGAGTTGACCTGCCACCAAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-991s1c1
Sequence:CCGGCCCAAAGTACATTTGGTGGCACTCGAGTGCCACCAAATGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1200s1c1
Sequence:CCGGCAGGTCTTCTTTAGTTCAGAACTCGAGTTCTGAACTAAAGAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1203s1c1
Sequence:CCGGGTCTTCTTTAGTTCAGAACATCTCGAGATGTTCTGAACTAAAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1061s1c1
Sequence:CCGGCTTCCCTAAGATTTCCACCTTCTCGAGAAGGTGGAAATCTTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028146.1-156s1c1
Sequence:CCGGCCCTGAATGTTTCAGCTCATGCTCGAGCATGAGCTGAAACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-614s1c1
Sequence:CCGGGACTACCGTAATGGCACCATACTCGAGTATGGTGCCATTACGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-898s1c1
Sequence:CCGGGTGATTCCAAACAGGTTCAAACTCGAGTTTGAACCTGTTTGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028146
DBNDD1 MISSION shRNA shRNA Plasmid DNA
dysbindin (dystrobrevin binding protein 1) domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-997s1c1
Sequence:CCGGGTACATTTGGTGGCAGGTCAACTCGAGTTGACCTGCCACCAAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-991s1c1
Sequence:CCGGCCCAAAGTACATTTGGTGGCACTCGAGTGCCACCAAATGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1200s1c1
Sequence:CCGGCAGGTCTTCTTTAGTTCAGAACTCGAGTTCTGAACTAAAGAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1203s1c1
Sequence:CCGGGTCTTCTTTAGTTCAGAACATCTCGAGATGTTCTGAACTAAAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1061s1c1
Sequence:CCGGCTTCCCTAAGATTTCCACCTTCTCGAGAAGGTGGAAATCTTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028146.1-156s1c1
Sequence:CCGGCCCTGAATGTTTCAGCTCATGCTCGAGCATGAGCTGAAACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-614s1c1
Sequence:CCGGGACTACCGTAATGGCACCATACTCGAGTATGGTGCCATTACGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-898s1c1
Sequence:CCGGGTGATTCCAAACAGGTTCAAACTCGAGTTTGAACCTGTTTGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028146
DBNDD1 MISSION shRNA Lentiviral Transduction Particles
dysbindin (dystrobrevin binding protein 1) domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182491    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-997s1c1
Sequence:CCGGGTACATTTGGTGGCAGGTCAACTCGAGTTGACCTGCCACCAAATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182118    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-991s1c1
Sequence:CCGGCCCAAAGTACATTTGGTGGCACTCGAGTGCCACCAAATGTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176697    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1200s1c1
Sequence:CCGGCAGGTCTTCTTTAGTTCAGAACTCGAGTTCTGAACTAAAGAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1203s1c1
Sequence:CCGGGTCTTCTTTAGTTCAGAACATCTCGAGATGTTCTGAACTAAAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177831    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028146.1-1061s1c1
Sequence:CCGGCTTCCCTAAGATTTCCACCTTCTCGAGAAGGTGGAAATCTTAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028146.1-156s1c1
Sequence:CCGGCCCTGAATGTTTCAGCTCATGCTCGAGCATGAGCTGAAACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-614s1c1
Sequence:CCGGGACTACCGTAATGGCACCATACTCGAGTATGGTGCCATTACGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197721    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028146.1-898s1c1
Sequence:CCGGGTGATTCCAAACAGGTTCAAACTCGAGTTTGAACCTGTTTGGAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks