EMAIL THIS PAGE TO A FRIEND

DBNDD2

dysbindin (dystrobrevin binding protein 1) domain containing 2

167 Gene Product Result for
Synonyms: C20orf35 CK1BP HSMNP1
Gene ID:
Mouse(52840) dysbindin (dystrobrevin binding protein 1) domain containing 2
Rat(499941) dysbindin (dystrobrevin binding protein 1) domain containing 2
sheep(101109472) dysbindin (dystrobrevin binding protein 1) domain containing 2
naked mole-rat(101697679) dysbindin (dystrobrevin binding protein 1) domain containing 2
chicken(419180) dysbindin (dystrobrevin binding protein 1) domain containing 2
cow(507590) dysbindin (dystrobrevin binding protein 1) domain containing 2
domestic cat(101089595) dysbindin (dystrobrevin binding protein 1) domain containing 2
dog(477243) dysbindin (dystrobrevin binding protein 1) domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001048226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001048226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001048226 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048221 Rosetta Predictions human pricing
NM_001048222 Rosetta Predictions human pricing
NM_001048223 Rosetta Predictions human pricing
NM_001048224 Rosetta Predictions human pricing
NM_001048225 Rosetta Predictions human pricing
NM_001048226 Rosetta Predictions human pricing
NM_018478 Rosetta Predictions human pricing
NM_001047111 Rosetta Predictions rat pricing
NM_001048227 Rosetta Predictions mouse pricing
NM_001048228 Rosetta Predictions mouse pricing
NM_001048229 Rosetta Predictions mouse pricing
NM_026797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311732 predicted 861
2 SASI_Hs02_00311733 predicted 835
3 SASI_Hs02_00311734 predicted 884
4 SASI_Hs02_00311735 predicted 884
5 SASI_Hs02_00311736 predicted 805
6 SASI_Hs02_00311737 predicted 894
7 SASI_Hs02_00311738 predicted 799
8 SASI_Hs02_00311739 predicted 799
9 SASI_Hs02_00311740 predicted 798
10 SASI_Hs02_00311741 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311742 predicted 925
2 SASI_Hs02_00311743 predicted 900
3 SASI_Hs02_00311744 predicted 893
4 SASI_Hs02_00311745 predicted 898
5 SASI_Hs02_00311746 predicted 891
6 SASI_Hs02_00311747 predicted 890
7 SASI_Hs02_00311748 predicted 903
8 SASI_Hs02_00311749 predicted 924
9 SASI_Hs02_00311750 predicted 907
10 SASI_Hs02_00311751 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048223 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311752 predicted 815
2 SASI_Hs02_00311753 predicted 788
3 SASI_Hs02_00311754 predicted 836
4 SASI_Hs02_00311755 predicted 836
5 SASI_Hs02_00311756 predicted 753
6 SASI_Hs02_00311757 predicted 847
7 SASI_Hs02_00311758 predicted 759
8 SASI_Hs02_00311759 predicted 755
9 SASI_Hs02_00311760 predicted 749
10 SASI_Hs02_00311761 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311762 predicted 887
2 SASI_Hs02_00311763 predicted 853
3 SASI_Hs02_00311764 predicted 849
4 SASI_Hs02_00311765 predicted 857
5 SASI_Hs02_00311766 predicted 849
6 SASI_Hs02_00311767 predicted 851
7 SASI_Hs02_00311768 predicted 853
8 SASI_Hs02_00311769 predicted 874
9 SASI_Hs02_00311770 predicted 865
10 SASI_Hs02_00311771 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311772 predicted 835
2 SASI_Hs02_00311773 predicted 810
3 SASI_Hs02_00311774 predicted 808
4 SASI_Hs02_00311775 predicted 805
5 SASI_Hs02_00311776 predicted 800
6 SASI_Hs02_00311777 predicted 803
7 SASI_Hs02_00311778 predicted 805
8 SASI_Hs02_00311779 predicted 831
9 SASI_Hs02_00311780 predicted 814
10 SASI_Hs02_00311781 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311782 predicted 963
2 SASI_Hs02_00311783 predicted 939
3 SASI_Hs02_00311784 predicted 987
4 SASI_Hs02_00311785 predicted 988
5 SASI_Hs02_00311786 predicted 901
6 SASI_Hs02_00311787 predicted 997
7 SASI_Hs02_00311788 predicted 906
8 SASI_Hs02_00311789 predicted 899
9 SASI_Hs02_00311790 predicted 900
10 SASI_Hs02_00311791 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039251 predicted 476
2 SASI_Hs01_00039252 predicted 1177
3 SASI_Hs01_00039253 predicted 1141
4 SASI_Hs01_00039254 predicted 1144
5 SASI_Hs01_00039255 predicted 616
6 SASI_Hs01_00039256 predicted 522
7 SASI_Hs01_00039257 predicted 458
8 SASI_Hs01_00039258 predicted 1136
9 SASI_Hs01_00039259 predicted 1145
10 SASI_Hs01_00039260 predicted 1127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206025 predicted 308
2 SASI_Rn02_00206026 predicted 527
3 SASI_Rn02_00206027 predicted 506
4 SASI_Rn02_00206028 predicted 626
5 SASI_Rn02_00206029 predicted 813
6 SASI_Rn02_00206030 predicted 239
7 SASI_Rn02_00206031 predicted 348
8 SASI_Rn02_00206032 predicted 322
9 SASI_Rn02_00206033 predicted 727
10 SASI_Rn02_00206034 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292259 predicted 650
2 SASI_Mm02_00292260 predicted 974
3 SASI_Mm02_00292261 predicted 929
4 SASI_Mm02_00292262 predicted 482
5 SASI_Mm02_00292263 predicted 582
6 SASI_Mm02_00292264 predicted 1055
7 SASI_Mm02_00292265 predicted 1023
8 SASI_Mm02_00292266 predicted 711
9 SASI_Mm02_00292267 predicted 697
10 SASI_Mm02_00292268 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292269 predicted 681
2 SASI_Mm02_00292270 predicted 1000
3 SASI_Mm02_00292271 predicted 959
4 SASI_Mm02_00292272 predicted 504
5 SASI_Mm02_00292273 predicted 604
6 SASI_Mm02_00292274 predicted 1079
7 SASI_Mm02_00292275 predicted 1046
8 SASI_Mm02_00292276 predicted 736
9 SASI_Mm02_00292277 predicted 724
10 SASI_Mm02_00292278 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292279 predicted 678
2 SASI_Mm02_00292280 predicted 995
3 SASI_Mm02_00292281 predicted 960
4 SASI_Mm02_00292282 predicted 515
5 SASI_Mm02_00292283 predicted 604
6 SASI_Mm02_00292284 predicted 1086
7 SASI_Mm02_00292285 predicted 1045
8 SASI_Mm02_00292286 predicted 734
9 SASI_Mm02_00292287 predicted 724
10 SASI_Mm02_00292288 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183521 predicted 779
2 SASI_Mm02_00330920 predicted 1101
3 SASI_Mm02_00330921 predicted 1060
4 SASI_Mm01_00183523 predicted 617
5 SASI_Mm01_00183524 predicted 711
6 SASI_Mm02_00330922 predicted 1182
7 SASI_Mm02_00330923 predicted 1154
8 SASI_Mm02_00330924 predicted 836
9 SASI_Mm02_00330925 predicted 824
10 SASI_Mm02_00330926 predicted 1140
11 SASI_Mm01_00183520 predicted 798
12 SASI_Mm01_00183522 predicted 581
13 SASI_Mm01_00183525 predicted 574
14 SASI_Mm01_00183526 predicted 620
15 SASI_Mm01_00183527 predicted 455
16 SASI_Mm01_00183528 predicted 548
17 SASI_Mm01_00183529 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026797
VALIDATED
DBNDD2 MISSION shRNA Bacterial Glycerol Stock
dysbindin (dystrobrevin binding protein 1) domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-766s1c1
Sequence:CCGGCGCAGTCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-546s1c1
Sequence:CCGGCTCGTCTATGGAAGTGAATGTCTCGAGACATTCACTTCCATAGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-616s1c1
Sequence:CCGGGCAGATGTGTTCTTGCCTTGTCTCGAGACAAGGCAAGAACACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-577s1c1
Sequence:CCGGGAGCAAGTGGAGTTTATTGATCTCGAGATCAATAAACTCCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-586s1c1
Sequence:CCGGGAGTTTATTGATCTTGCGGATCTCGAGATCCGCAAGATCAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-448s1c1
Sequence:CCGGCAGAAGTTCTTTGAGGACATTCTCGAGAATGTCCTCAAAGAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-945s1c1
Sequence:CCGGGACCTGACACTTTCCTTACTTCTCGAGAAGTAAGGAAAGTGTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026797.2-1106s1c1
Sequence:CCGGGGGAACAGGATATGGTATAAACTCGAGTTTATACCATATCCTGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026797
VALIDATED
DBNDD2 MISSION shRNA shRNA Plasmid DNA
dysbindin (dystrobrevin binding protein 1) domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-766s1c1
Sequence:CCGGCGCAGTCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-546s1c1
Sequence:CCGGCTCGTCTATGGAAGTGAATGTCTCGAGACATTCACTTCCATAGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-616s1c1
Sequence:CCGGGCAGATGTGTTCTTGCCTTGTCTCGAGACAAGGCAAGAACACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-577s1c1
Sequence:CCGGGAGCAAGTGGAGTTTATTGATCTCGAGATCAATAAACTCCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-586s1c1
Sequence:CCGGGAGTTTATTGATCTTGCGGATCTCGAGATCCGCAAGATCAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-448s1c1
Sequence:CCGGCAGAAGTTCTTTGAGGACATTCTCGAGAATGTCCTCAAAGAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-945s1c1
Sequence:CCGGGACCTGACACTTTCCTTACTTCTCGAGAAGTAAGGAAAGTGTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026797.2-1106s1c1
Sequence:CCGGGGGAACAGGATATGGTATAAACTCGAGTTTATACCATATCCTGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026797
VALIDATED
DBNDD2 MISSION shRNA Lentiviral Transduction Particles
dysbindin (dystrobrevin binding protein 1) domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-766s1c1
Sequence:CCGGCGCAGTCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198182    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-546s1c1
Sequence:CCGGCTCGTCTATGGAAGTGAATGTCTCGAGACATTCACTTCCATAGACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026797.1-616s1c1
Sequence:CCGGGCAGATGTGTTCTTGCCTTGTCTCGAGACAAGGCAAGAACACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-577s1c1
Sequence:CCGGGAGCAAGTGGAGTTTATTGATCTCGAGATCAATAAACTCCACTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-586s1c1
Sequence:CCGGGAGTTTATTGATCTTGCGGATCTCGAGATCCGCAAGATCAATAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-448s1c1
Sequence:CCGGCAGAAGTTCTTTGAGGACATTCTCGAGAATGTCCTCAAAGAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026797.1-945s1c1
Sequence:CCGGGACCTGACACTTTCCTTACTTCTCGAGAAGTAAGGAAAGTGTCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217585    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026797.2-1106s1c1
Sequence:CCGGGGGAACAGGATATGGTATAAACTCGAGTTTATACCATATCCTGTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018478
VALIDATED
DBNDD2 MISSION shRNA Bacterial Glycerol Stock
dysbindin (dystrobrevin binding protein 1) domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-925s1c1
Sequence:CCGGCCAAGTGATGATGGAGCAGATCTCGAGATCTGCTCCATCATCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-715s1c1
Sequence:CCGGCTGGAGCAAGTAGAACTTATTCTCGAGAATAAGTTCTACTTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-616s1c1
Sequence:CCGGCCAGAGACAGAGTTTGTCTTTCTCGAGAAAGACAAACTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-919s1c1
Sequence:CCGGCCAAATCCAAGTGATGATGGACTCGAGTCCATCATCACTTGGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-913s1c1
Sequence:CCGGCATAGCCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018478.1-760s1c1
Sequence:CCGGGATGTGTTCTTGCCTTGCGAACTCGAGTTCGCAAGGCAAGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-478s1c1
Sequence:CCGGCTCTTTCGACTTTGCAGCTGTCTCGAGACAGCTGCAAAGTCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-751s1c1
Sequence:CCGGGATGCAGCAGATGTGTTCTTGCTCGAGCAAGAACACATCTGCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018478
VALIDATED
DBNDD2 MISSION shRNA shRNA Plasmid DNA
dysbindin (dystrobrevin binding protein 1) domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-925s1c1
Sequence:CCGGCCAAGTGATGATGGAGCAGATCTCGAGATCTGCTCCATCATCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-715s1c1
Sequence:CCGGCTGGAGCAAGTAGAACTTATTCTCGAGAATAAGTTCTACTTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-616s1c1
Sequence:CCGGCCAGAGACAGAGTTTGTCTTTCTCGAGAAAGACAAACTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-919s1c1
Sequence:CCGGCCAAATCCAAGTGATGATGGACTCGAGTCCATCATCACTTGGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-913s1c1
Sequence:CCGGCATAGCCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018478.1-760s1c1
Sequence:CCGGGATGTGTTCTTGCCTTGCGAACTCGAGTTCGCAAGGCAAGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-478s1c1
Sequence:CCGGCTCTTTCGACTTTGCAGCTGTCTCGAGACAGCTGCAAAGTCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-751s1c1
Sequence:CCGGGATGCAGCAGATGTGTTCTTGCTCGAGCAAGAACACATCTGCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018478
VALIDATED
DBNDD2 MISSION shRNA Lentiviral Transduction Particles
dysbindin (dystrobrevin binding protein 1) domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-925s1c1
Sequence:CCGGCCAAGTGATGATGGAGCAGATCTCGAGATCTGCTCCATCATCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-715s1c1
Sequence:CCGGCTGGAGCAAGTAGAACTTATTCTCGAGAATAAGTTCTACTTGCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-616s1c1
Sequence:CCGGCCAGAGACAGAGTTTGTCTTTCTCGAGAAAGACAAACTCTGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155823    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-919s1c1
Sequence:CCGGCCAAATCCAAGTGATGATGGACTCGAGTCCATCATCACTTGGATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018478.1-913s1c1
Sequence:CCGGCATAGCCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018478.1-760s1c1
Sequence:CCGGGATGTGTTCTTGCCTTGCGAACTCGAGTTCGCAAGGCAAGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-478s1c1
Sequence:CCGGCTCTTTCGACTTTGCAGCTGTCTCGAGACAGCTGCAAAGTCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156956    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018478.1-751s1c1
Sequence:CCGGGATGCAGCAGATGTGTTCTTGCTCGAGCAAGAACACATCTGCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001048226
DBNDD2 MISSION shRNA Bacterial Glycerol Stock
dysbindin (dystrobrevin binding protein 1) domain containing 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000353033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-422s21c1
Sequence:CCGGGATGTGTTCTTGCCTTGCGAACTCGAGTTCGCAAGGCAAGAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-377s21c1
Sequence:CCGGCTGGAGCAAGTAGAACTTATTCTCGAGAATAAGTTCTACTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-278s21c1
Sequence:CCGGCCAGAGACAGAGTTTGTCTTTCTCGAGAAAGACAAACTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048226.1-673s21c1
Sequence:CCGGCATAGCCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001048226
DBNDD2 MISSION shRNA shRNA Plasmid DNA
dysbindin (dystrobrevin binding protein 1) domain containing 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000353033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-422s21c1
Sequence:CCGGGATGTGTTCTTGCCTTGCGAACTCGAGTTCGCAAGGCAAGAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-377s21c1
Sequence:CCGGCTGGAGCAAGTAGAACTTATTCTCGAGAATAAGTTCTACTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-278s21c1
Sequence:CCGGCCAGAGACAGAGTTTGTCTTTCTCGAGAAAGACAAACTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048226.1-673s21c1
Sequence:CCGGCATAGCCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001048226
DBNDD2 MISSION shRNA Lentiviral Transduction Particles
dysbindin (dystrobrevin binding protein 1) domain containing 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000353033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-422s21c1
Sequence:CCGGGATGTGTTCTTGCCTTGCGAACTCGAGTTCGCAAGGCAAGAACACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343977    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-377s21c1
Sequence:CCGGCTGGAGCAAGTAGAACTTATTCTCGAGAATAAGTTCTACTTGCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001048226.1-278s21c1
Sequence:CCGGCCAGAGACAGAGTTTGTCTTTCTCGAGAAAGACAAACTCTGTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001048226.1-673s21c1
Sequence:CCGGCATAGCCCAAATCCAAGTGATCTCGAGATCACTTGGATTTGGGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks