EMAIL THIS PAGE TO A FRIEND

DBNL

drebrin-like

74 Gene Product Result for
Synonyms: ABP1 HIP-55 HIP55 SH3P7
Gene ID:
Mouse(13169) drebrin-like
Rat(83527) drebrin-like
chicken(425994) drebrin-like
dog(607412) drebrin-like
cow(514706) drebrin-like
sheep(101123075) drebrin-like
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013810 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013810 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013810 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014436 Rosetta Predictions human pricing
NM_001122956 Rosetta Predictions human pricing
NM_014063 Rosetta Predictions human pricing
NM_031352 Rosetta Predictions rat pricing
NM_013810 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306540 predicted 1836
2 SASI_Hs01_00075552 predicted 358
3 SASI_Hs01_00075553 predicted 502
4 SASI_Hs01_00075554 predicted 1330
5 SASI_Hs01_00075555 predicted 1868
6 SASI_Hs01_00075556 predicted 1150
7 SASI_Hs01_00075557 predicted 1492
8 SASI_Hs01_00075558 predicted 314
9 SASI_Hs01_00075559 predicted 1874
10 SASI_Hs01_00075560 predicted 1550
11 SASI_Hs01_00075561 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327577 predicted 1864
2 SASI_Hs02_00327578 predicted 359
3 SASI_Hs02_00327579 predicted 503
4 SASI_Hs02_00327580 predicted 1350
5 SASI_Hs02_00327581 predicted 1895
6 SASI_Hs02_00327582 predicted 1171
7 SASI_Hs02_00327583 predicted 1515
8 SASI_Hs02_00327584 predicted 307
9 SASI_Hs02_00327585 predicted 1899
10 SASI_Hs02_00327586 predicted 1584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345082 predicted 1848
2 SASI_Hs01_00012281 predicted 357
3 SASI_Hs01_00012282 predicted 499
4 SASI_Hs01_00012283 predicted 1332
5 SASI_Hs01_00012284 predicted 1865
6 SASI_Hs01_00012285 predicted 1144
7 SASI_Hs01_00012286 predicted 1493
8 SASI_Hs01_00012287 predicted 315
9 SASI_Hs01_00012288 predicted 1878
10 SASI_Hs01_00012289 predicted 1554
11 SASI_Hs01_00012290 predicted 1507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031352 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073206 predicted 991
2 SASI_Rn01_00073207 predicted 1363
3 SASI_Rn02_00264599 predicted 982
4 SASI_Rn01_00073208 predicted 410
5 SASI_Rn01_00073209 predicted 808
6 SASI_Rn01_00073210 predicted 1262
7 SASI_Rn01_00073211 predicted 1266
8 SASI_Rn02_00264600 predicted 344
9 SASI_Rn01_00073212 predicted 415
10 SASI_Rn01_00073213 predicted 301
11 SASI_Rn01_00073214 predicted 312
12 SASI_Rn01_00073215 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322770 predicted 395
2 SASI_Mm01_00043164 predicted 1050
3 SASI_Mm01_00043166 predicted 274
4 SASI_Mm01_00043170 predicted 1784
5 SASI_Mm01_00043167 predicted 839
6 SASI_Mm01_00043168 predicted 753
7 SASI_Mm01_00043169 predicted 443
8 SASI_Mm01_00043171 predicted 1188
9 SASI_Mm01_00043172 predicted 601
10 SASI_Mm01_00043173 predicted 1014
11 SASI_Mm01_00043165 predicted 1110
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014063
VALIDATED
DBNL MISSION shRNA Bacterial Glycerol Stock
drebrin-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-1732s21c1
Sequence:CCGGTCTGGCTGCCTTCTGCATTTACTCGAGTAAATGCAGAAGGCAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-592s21c1
Sequence:CCGGCCAATGCCGTGTCTGAGATTACTCGAGTAATCTCAGACACGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-1257s21c1
Sequence:CCGGGACGACACAGAGATCTCCTTTCTCGAGAAAGGAGATCTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-470s21c1
Sequence:CCGGGCCTGAGTGCATCATGGAGAACTCGAGTTCTCCATGATGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-314s21c1
Sequence:CCGGCAACTCTGGACTGCCCAAATTCTCGAGAATTTGGGCAGTCCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014063.5-1731s1c1
Sequence:CCGGCCACTGTTTAGAATGACCCTTCTCGAGAAGGGTCATTCTAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014063.5-209s1c1
Sequence:CCGGCGGGAAGGTGATGTACGCCTTCTCGAGAAGGCGTACATCACCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-404s1c1
Sequence:CCGGGCCTGAGTGCATCATGGAGAACTCGAGTTCTCCATGATGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-1191s1c1
Sequence:CCGGGACGACACAGAGATCTCCTTTCTCGAGAAAGGAGATCTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-761s1c1
Sequence:CCGGAGTGGTTTCAAGGAACCGAAACTCGAGTTTCGGTTCCTTGAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014063
VALIDATED
DBNL MISSION shRNA shRNA Plasmid DNA
drebrin-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-1732s21c1
Sequence:CCGGTCTGGCTGCCTTCTGCATTTACTCGAGTAAATGCAGAAGGCAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-592s21c1
Sequence:CCGGCCAATGCCGTGTCTGAGATTACTCGAGTAATCTCAGACACGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-1257s21c1
Sequence:CCGGGACGACACAGAGATCTCCTTTCTCGAGAAAGGAGATCTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-470s21c1
Sequence:CCGGGCCTGAGTGCATCATGGAGAACTCGAGTTCTCCATGATGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-314s21c1
Sequence:CCGGCAACTCTGGACTGCCCAAATTCTCGAGAATTTGGGCAGTCCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014063.5-1731s1c1
Sequence:CCGGCCACTGTTTAGAATGACCCTTCTCGAGAAGGGTCATTCTAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014063.5-209s1c1
Sequence:CCGGCGGGAAGGTGATGTACGCCTTCTCGAGAAGGCGTACATCACCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-404s1c1
Sequence:CCGGGCCTGAGTGCATCATGGAGAACTCGAGTTCTCCATGATGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-1191s1c1
Sequence:CCGGGACGACACAGAGATCTCCTTTCTCGAGAAAGGAGATCTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-761s1c1
Sequence:CCGGAGTGGTTTCAAGGAACCGAAACTCGAGTTTCGGTTCCTTGAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014063
VALIDATED
DBNL MISSION shRNA Lentiviral Transduction Particles
drebrin-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-1732s21c1
Sequence:CCGGTCTGGCTGCCTTCTGCATTTACTCGAGTAAATGCAGAAGGCAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-592s21c1
Sequence:CCGGCCAATGCCGTGTCTGAGATTACTCGAGTAATCTCAGACACGGCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-1257s21c1
Sequence:CCGGGACGACACAGAGATCTCCTTTCTCGAGAAAGGAGATCTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-470s21c1
Sequence:CCGGGCCTGAGTGCATCATGGAGAACTCGAGTTCTCCATGATGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_014063.6-314s21c1
Sequence:CCGGCAACTCTGGACTGCCCAAATTCTCGAGAATTTGGGCAGTCCAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116477    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014063.5-1731s1c1
Sequence:CCGGCCACTGTTTAGAATGACCCTTCTCGAGAAGGGTCATTCTAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014063.5-209s1c1
Sequence:CCGGCGGGAAGGTGATGTACGCCTTCTCGAGAAGGCGTACATCACCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-404s1c1
Sequence:CCGGGCCTGAGTGCATCATGGAGAACTCGAGTTCTCCATGATGCACTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-1191s1c1
Sequence:CCGGGACGACACAGAGATCTCCTTTCTCGAGAAAGGAGATCTCTGTGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014063.5-761s1c1
Sequence:CCGGAGTGGTTTCAAGGAACCGAAACTCGAGTTTCGGTTCCTTGAAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013810
VALIDATED
DBNL MISSION shRNA Bacterial Glycerol Stock
drebrin-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013810.1-1737s1c1
Sequence:CCGGCCCTTGGGAATTGTGAACTTACTCGAGTAAGTTCACAATTCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-1290s1c1
Sequence:CCGGCTTTGGCATGTTTCCTGCCAACTCGAGTTGGCAGGAAACATGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-406s1c1
Sequence:CCGGGAGTGCATCATGGAGAAGGTTCTCGAGAACCTTCTCCATGATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-1016s1c1
Sequence:CCGGCCCAGACAGAAGAAGAACCTACTCGAGTAGGTTCTTCTTCTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-525s1c1
Sequence:CCGGCAATGCCATATCTGAGATCAACTCGAGTTGATCTCAGATATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013810
VALIDATED
DBNL MISSION shRNA shRNA Plasmid DNA
drebrin-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013810.1-1737s1c1
Sequence:CCGGCCCTTGGGAATTGTGAACTTACTCGAGTAAGTTCACAATTCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-1290s1c1
Sequence:CCGGCTTTGGCATGTTTCCTGCCAACTCGAGTTGGCAGGAAACATGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-406s1c1
Sequence:CCGGGAGTGCATCATGGAGAAGGTTCTCGAGAACCTTCTCCATGATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-1016s1c1
Sequence:CCGGCCCAGACAGAAGAAGAACCTACTCGAGTAGGTTCTTCTTCTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-525s1c1
Sequence:CCGGCAATGCCATATCTGAGATCAACTCGAGTTGATCTCAGATATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013810
VALIDATED
DBNL MISSION shRNA Lentiviral Transduction Particles
drebrin-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013810.1-1737s1c1
Sequence:CCGGCCCTTGGGAATTGTGAACTTACTCGAGTAAGTTCACAATTCCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-1290s1c1
Sequence:CCGGCTTTGGCATGTTTCCTGCCAACTCGAGTTGGCAGGAAACATGCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-406s1c1
Sequence:CCGGGAGTGCATCATGGAGAAGGTTCTCGAGAACCTTCTCCATGATGCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-1016s1c1
Sequence:CCGGCCCAGACAGAAGAAGAACCTACTCGAGTAGGTTCTTCTTCTGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013810.1-525s1c1
Sequence:CCGGCAATGCCATATCTGAGATCAACTCGAGTTGATCTCAGATATGGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks