EMAIL THIS PAGE TO A FRIEND

DBP

D site of albumin promoter (albumin D-box) binding protein

57 Gene Product Result for
Synonyms: DABP
UniProtKB ID: Q10586, A2I2P4
Gene ID:
Human(1628) Summary: The protein encoded by this gene is a member of the PAR bZIP transcription factor family and binds to specific sequences in the promoters of several genes, such as albumin, CYP2A4, and CYP2A5. The encoded protein can bind DNA as a homo- or heterodimer and is involved in the regulation of some circadian rhythym genes. [provided by RefSeq, Jan 2012]
Mouse(13170) D site albumin promoter binding protein
Rat(24309) D site of albumin promoter (albumin D-box) binding protein
dog(100685867) D site of albumin promoter (albumin D-box) binding protein
domestic cat(101086361) D site of albumin promoter (albumin D-box) binding protein
cow(503577) D site of albumin promoter (albumin D-box) binding protein
sheep(100192428) D site of albumin promoter (albumin D-box) binding protein
Domestic Rabbit(100008994) D site of albumin promoter (albumin D-box) binding protein
domestic guinea pig(100730328) D site of albumin promoter (albumin D-box) binding protein
naked mole-rat(101722651) D site of albumin promoter (albumin D-box) binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016974 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016974 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016974 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001352 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001352 Rosetta Predictions human pricing
NM_012543 Rosetta Predictions rat pricing
NM_016974 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331681 predicted 1321
2 SASI_Hs01_00071613 predicted 1058
3 SASI_Hs01_00071614 predicted 1159
4 SASI_Hs02_00331682 predicted 1394
5 SASI_Hs01_00071615 predicted 1068
6 SASI_Hs01_00071616 predicted 1201
7 SASI_Hs01_00071618 predicted 1027
8 SASI_Hs01_00071619 predicted 1161
9 SASI_Hs01_00071620 predicted 1058
10 SASI_Hs01_00071621 predicted 1060
11 SASI_Hs01_00071617 predicted 1076
12 SASI_Hs01_00071622 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259620 predicted 1287
2 SASI_Rn01_00075152 predicted 1187
3 SASI_Rn01_00075153 predicted 969
4 SASI_Rn01_00075154 predicted 1360
5 SASI_Rn01_00075156 predicted 945
6 SASI_Rn01_00075157 predicted 1013
7 SASI_Rn02_00259621 predicted 1060
8 SASI_Rn01_00075158 predicted 913
9 SASI_Rn01_00075159 predicted 1337
10 SASI_Rn01_00075160 predicted 1298
11 SASI_Rn01_00075155 predicted 1069
12 SASI_Rn01_00075161 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016974 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089356 predicted 561
2 SASI_Mm02_00323822 predicted 1538
3 SASI_Mm01_00089358 predicted 1452
4 SASI_Mm02_00323823 predicted 1653
5 SASI_Mm01_00089359 predicted 1373
6 SASI_Mm02_00323824 predicted 1535
7 SASI_Mm01_00089360 predicted 1444
8 SASI_Mm01_00089361 predicted 1138
9 SASI_Mm02_00323825 predicted 1541
10 SASI_Mm02_00323826 predicted 1513
11 SASI_Mm01_00089357 predicted 1396
12 SASI_Mm01_00089362 predicted 1015
13 SASI_Mm01_00089363 predicted 493
14 SASI_Mm01_00089364 predicted 1093
15 SASI_Mm01_00089365 predicted 1198
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016974
DBP MISSION shRNA Bacterial Glycerol Stock
D site of albumin promoter (albumin D-box) binding protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016974.1-1406s1c1
Sequence:CCGGGCTCAGACTTACACCTGACTTCTCGAGAAGTCAGGTGTAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1171s1c1
Sequence:CCGGCGGAGGTACAAGAACAATGAACTCGAGTTCATTGTTCTTGTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-988s1c1
Sequence:CCGGGAGGTGCTAATGACCTTTGAACTCGAGTTCAAAGGTCATTAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1199s1c1
Sequence:CCGGAGAGGTCGAGAGATGCAAGAACTCGAGTTCTTGCATCTCTCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1170s1c1
Sequence:CCGGCCGGAGGTACAAGAACAATGACTCGAGTCATTGTTCTTGTACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016974.3-1009s21c1
Sequence:CCGGATCTCGCCCTGTCAAGCATTCCTCGAGGAATGCTTGACAGGGCGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016974.3-1095s21c1
Sequence:CCGGATCATGAAGAAGGCAAGGAAACTCGAGTTTCCTTGCCTTCTTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016974
DBP MISSION shRNA shRNA Plasmid DNA
D site of albumin promoter (albumin D-box) binding protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016974.1-1406s1c1
Sequence:CCGGGCTCAGACTTACACCTGACTTCTCGAGAAGTCAGGTGTAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1171s1c1
Sequence:CCGGCGGAGGTACAAGAACAATGAACTCGAGTTCATTGTTCTTGTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-988s1c1
Sequence:CCGGGAGGTGCTAATGACCTTTGAACTCGAGTTCAAAGGTCATTAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1199s1c1
Sequence:CCGGAGAGGTCGAGAGATGCAAGAACTCGAGTTCTTGCATCTCTCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1170s1c1
Sequence:CCGGCCGGAGGTACAAGAACAATGACTCGAGTCATTGTTCTTGTACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016974.3-1009s21c1
Sequence:CCGGATCTCGCCCTGTCAAGCATTCCTCGAGGAATGCTTGACAGGGCGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016974.3-1095s21c1
Sequence:CCGGATCATGAAGAAGGCAAGGAAACTCGAGTTTCCTTGCCTTCTTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016974
DBP MISSION shRNA Lentiviral Transduction Particles
D site of albumin promoter (albumin D-box) binding protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016974.1-1406s1c1
Sequence:CCGGGCTCAGACTTACACCTGACTTCTCGAGAAGTCAGGTGTAAGTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1171s1c1
Sequence:CCGGCGGAGGTACAAGAACAATGAACTCGAGTTCATTGTTCTTGTACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-988s1c1
Sequence:CCGGGAGGTGCTAATGACCTTTGAACTCGAGTTCAAAGGTCATTAGCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1199s1c1
Sequence:CCGGAGAGGTCGAGAGATGCAAGAACTCGAGTTCTTGCATCTCTCGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016974.1-1170s1c1
Sequence:CCGGCCGGAGGTACAAGAACAATGACTCGAGTCATTGTTCTTGTACCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016974.3-1009s21c1
Sequence:CCGGATCTCGCCCTGTCAAGCATTCCTCGAGGAATGCTTGACAGGGCGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016974.3-1095s21c1
Sequence:CCGGATCATGAAGAAGGCAAGGAAACTCGAGTTTCCTTGCCTTCTTCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001352
VALIDATED
DBP MISSION shRNA Bacterial Glycerol Stock
D site of albumin promoter (albumin D-box) binding protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001352.2-1325s1c1
Sequence:CCGGACATCCCCACCTGGCGGAGCTCTCGAGAGCTCCGCCAGGTGGGGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001352.2-1013s1c1
Sequence:CCGGCGAAGACATCGCTTCTCAGAACTCGAGTTCTGAGAAGCGATGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-1121s1c1
Sequence:CCGGCGGTACAAGAACAACGAGGCACTCGAGTGCCTCGTTGTTCTTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-963s1c1
Sequence:CCGGCAGCTGATCTTGCCCTATCAACTCGAGTTGATAGGGCAAGATCAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-932s1c1
Sequence:CCGGGTGGAGGTGTTGATGACCTTTCTCGAGAAAGGTCATCAACACCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1020s21c1
Sequence:CCGGATCTTGCCCTATCAAGCATTCCTCGAGGAATGCTTGATAGGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001352.3-1476s21c1
Sequence:CCGGGACGTGATAATGCAGATAAATCTCGAGATTTATCTGCATTATCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1052s21c1
Sequence:CCGGACCTTTGACCCTCGAAGACATCTCGAGATGTCTTCGAGGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1219s21c1
Sequence:CCGGGCTCAAGGAGAACCAGATATCCTCGAGGATATCTGGTTCTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1104s21c1
Sequence:CCGGCAATCATGAAGAAGGCAAGAACTCGAGTTCTTGCCTTCTTCATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001352
VALIDATED
DBP MISSION shRNA shRNA Plasmid DNA
D site of albumin promoter (albumin D-box) binding protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001352.2-1325s1c1
Sequence:CCGGACATCCCCACCTGGCGGAGCTCTCGAGAGCTCCGCCAGGTGGGGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001352.2-1013s1c1
Sequence:CCGGCGAAGACATCGCTTCTCAGAACTCGAGTTCTGAGAAGCGATGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-1121s1c1
Sequence:CCGGCGGTACAAGAACAACGAGGCACTCGAGTGCCTCGTTGTTCTTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-963s1c1
Sequence:CCGGCAGCTGATCTTGCCCTATCAACTCGAGTTGATAGGGCAAGATCAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-932s1c1
Sequence:CCGGGTGGAGGTGTTGATGACCTTTCTCGAGAAAGGTCATCAACACCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1020s21c1
Sequence:CCGGATCTTGCCCTATCAAGCATTCCTCGAGGAATGCTTGATAGGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001352.3-1476s21c1
Sequence:CCGGGACGTGATAATGCAGATAAATCTCGAGATTTATCTGCATTATCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1052s21c1
Sequence:CCGGACCTTTGACCCTCGAAGACATCTCGAGATGTCTTCGAGGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1219s21c1
Sequence:CCGGGCTCAAGGAGAACCAGATATCCTCGAGGATATCTGGTTCTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1104s21c1
Sequence:CCGGCAATCATGAAGAAGGCAAGAACTCGAGTTCTTGCCTTCTTCATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001352
VALIDATED
DBP MISSION shRNA Lentiviral Transduction Particles
D site of albumin promoter (albumin D-box) binding protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001352.2-1325s1c1
Sequence:CCGGACATCCCCACCTGGCGGAGCTCTCGAGAGCTCCGCCAGGTGGGGATGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_001352.2-1013s1c1
Sequence:CCGGCGAAGACATCGCTTCTCAGAACTCGAGTTCTGAGAAGCGATGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-1121s1c1
Sequence:CCGGCGGTACAAGAACAACGAGGCACTCGAGTGCCTCGTTGTTCTTGTACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-963s1c1
Sequence:CCGGCAGCTGATCTTGCCCTATCAACTCGAGTTGATAGGGCAAGATCAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001352.2-932s1c1
Sequence:CCGGGTGGAGGTGTTGATGACCTTTCTCGAGAAAGGTCATCAACACCTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1020s21c1
Sequence:CCGGATCTTGCCCTATCAAGCATTCCTCGAGGAATGCTTGATAGGGCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235685    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001352.3-1476s21c1
Sequence:CCGGGACGTGATAATGCAGATAAATCTCGAGATTTATCTGCATTATCACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1052s21c1
Sequence:CCGGACCTTTGACCCTCGAAGACATCTCGAGATGTCTTCGAGGGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1219s21c1
Sequence:CCGGGCTCAAGGAGAACCAGATATCCTCGAGGATATCTGGTTCTCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001352.3-1104s21c1
Sequence:CCGGCAATCATGAAGAAGGCAAGAACTCGAGTTCTTGCCTTCTTCATGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks