EMAIL THIS PAGE TO A FRIEND

DBR1

debranching RNA lariats 1

UniProtKB ID: Q9UK59, Q96GH0, Q9NXQ6
Gene ID:
Human(51163) Summary: The protein encoded by this gene is an RNA lariat debranching enzyme that hydrolyzes 2'-5' prime branched phosphodiester bonds. The encoded protein specifically targets the bonds at the branch point of excised lariat intron RNA, converting them to linear molecules that are then degraded. This protein may also be involved in retroviral replication. [provided by RefSeq, Nov 2011]
Mouse(83703) debranching enzyme homolog 1 (S. cerevisiae)
Rat(681234) debranching enzyme homolog 1 (S. cerevisiae)
Zebrafish(323746) debranching enzyme homolog 1 (S. cerevisiae)
Thale Cress(829305) RNA Lariat debranching enzyme
cow(530188) debranching enzyme homolog 1 (S. cerevisiae)
Horse(100053540) debranching enzyme homolog 1 (S. cerevisiae)
domestic cat(101093293) debranching enzyme homolog 1 (S. cerevisiae)
dog(609194) debranching enzyme homolog 1 (S. cerevisiae)
chicken(429118) debranching enzyme homolog 1 (S. cerevisiae)
sheep(101111415) debranching enzyme homolog 1 (S. cerevisiae)
naked mole-rat(101707241) debranching RNA lariats 1
domestic guinea pig(100726324) debranching RNA lariats 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016216 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031403 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031403 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031403 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016216 Rosetta Predictions human pricing
NM_001109437 Rosetta Predictions rat pricing
NM_031403 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013025 predicted 1194
2 SASI_Hs01_00013026 predicted 889
3 SASI_Hs01_00013027 predicted 386
4 SASI_Hs02_00349070 predicted 300
5 SASI_Hs01_00013028 predicted 1460
6 SASI_Hs02_00349071 predicted 560
7 SASI_Hs01_00013029 predicted 778
8 SASI_Hs01_00013030 predicted 1127
9 SASI_Hs01_00013031 predicted 988
10 SASI_Hs01_00013032 predicted 1216
11 SASI_Hs01_00013024 predicted 983
12 SASI_Hs01_00013033 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248397 predicted 403
2 SASI_Rn02_00248398 predicted 408
3 SASI_Rn02_00248399 predicted 1693
4 SASI_Rn02_00248400 predicted 1366
5 SASI_Rn02_00248401 predicted 539
6 SASI_Rn02_00248402 predicted 365
7 SASI_Rn02_00248403 predicted 355
8 SASI_Rn02_00248404 predicted 1504
9 SASI_Rn02_00248405 predicted 615
10 SASI_Rn02_00248406 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031403 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099605 predicted 383
2 SASI_Mm01_00099606 predicted 997
3 SASI_Mm02_00337151 predicted 568
4 SASI_Mm01_00099608 predicted 1091
5 SASI_Mm01_00099609 predicted 381
6 SASI_Mm01_00099610 predicted 609
7 SASI_Mm01_00099611 predicted 301
8 SASI_Mm01_00099613 predicted 1068
9 SASI_Mm02_00337152 predicted 1680
10 SASI_Mm01_00099614 predicted 657
11 SASI_Mm01_00099607 predicted 501
12 SASI_Mm01_00099612 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016216
VALIDATED
DBR1 MISSION shRNA Bacterial Glycerol Stock
debranching RNA lariats 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-1484s1c1
Sequence:CCGGCCATCGGTAGAACCTTCTGATCTCGAGATCAGAAGGTTCTACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-303s1c1
Sequence:CCGGCCAAGTATCGTCACATGCAAACTCGAGTTTGCATGTGACGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016216.2-319s1c1
Sequence:CCGGGCAAACCTTCTACAGGTATTACTCGAGTAATACCTGTAGAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016216.2-2094s1c1
Sequence:CCGGGCCGACAATTTACTTGTCTTACTCGAGTAAGACAAGTAAATTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016216.2-2384s1c1
Sequence:CCGGGCTATAATATGGGACCATAAACTCGAGTTTATGGTCCCATATTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016216.2-959s1c1
Sequence:CCGGGCTCCTGATTACTTGGAATATCTCGAGATATTCCAAGTAATCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_016216.2-1714s1c1
Sequence:CCGGGAGGAGGAATCAAGCCATTTACTCGAGTAAATGGCTTGATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_016216.2-1343s1c1
Sequence:CCGGGAGAGTAATGACTCTGGAGAACTCGAGTTCTCCAGAGTCATTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-316s1c1
Sequence:CCGGCATGCAAACCTTCTACAGGTACTCGAGTACCTGTAGAAGGTTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016216.2-2372s21c1
Sequence:CCGGGCCAAGCACTCTGCTATAATACTCGAGTATTATAGCAGAGTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-1007s21c1
Sequence:CCGGGCTACGGATGATCTTATTAATCTCGAGATTAATAAGATCATCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-779s21c1
Sequence:CCGGGAGCATCTCAAACCTACTTATCTCGAGATAAGTAGGTTTGAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-568s21c1
Sequence:CCGGATCTACAATCAGGAGTATATACTCGAGTATATACTCCTGATTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016216.2-168s21c1
Sequence:CCGGGCGAGCTGGATAAGATCTATGCTCGAGCATAGATCTTATCCAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016216
VALIDATED
DBR1 MISSION shRNA shRNA Plasmid DNA
debranching RNA lariats 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-1484s1c1
Sequence:CCGGCCATCGGTAGAACCTTCTGATCTCGAGATCAGAAGGTTCTACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-303s1c1
Sequence:CCGGCCAAGTATCGTCACATGCAAACTCGAGTTTGCATGTGACGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016216.2-319s1c1
Sequence:CCGGGCAAACCTTCTACAGGTATTACTCGAGTAATACCTGTAGAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016216.2-2094s1c1
Sequence:CCGGGCCGACAATTTACTTGTCTTACTCGAGTAAGACAAGTAAATTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016216.2-2384s1c1
Sequence:CCGGGCTATAATATGGGACCATAAACTCGAGTTTATGGTCCCATATTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016216.2-959s1c1
Sequence:CCGGGCTCCTGATTACTTGGAATATCTCGAGATATTCCAAGTAATCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_016216.2-1714s1c1
Sequence:CCGGGAGGAGGAATCAAGCCATTTACTCGAGTAAATGGCTTGATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_016216.2-1343s1c1
Sequence:CCGGGAGAGTAATGACTCTGGAGAACTCGAGTTCTCCAGAGTCATTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-316s1c1
Sequence:CCGGCATGCAAACCTTCTACAGGTACTCGAGTACCTGTAGAAGGTTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016216.2-2372s21c1
Sequence:CCGGGCCAAGCACTCTGCTATAATACTCGAGTATTATAGCAGAGTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-1007s21c1
Sequence:CCGGGCTACGGATGATCTTATTAATCTCGAGATTAATAAGATCATCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-779s21c1
Sequence:CCGGGAGCATCTCAAACCTACTTATCTCGAGATAAGTAGGTTTGAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-568s21c1
Sequence:CCGGATCTACAATCAGGAGTATATACTCGAGTATATACTCCTGATTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016216.2-168s21c1
Sequence:CCGGGCGAGCTGGATAAGATCTATGCTCGAGCATAGATCTTATCCAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016216
VALIDATED
DBR1 MISSION shRNA Lentiviral Transduction Particles
debranching RNA lariats 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-1484s1c1
Sequence:CCGGCCATCGGTAGAACCTTCTGATCTCGAGATCAGAAGGTTCTACCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-303s1c1
Sequence:CCGGCCAAGTATCGTCACATGCAAACTCGAGTTTGCATGTGACGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016216.2-319s1c1
Sequence:CCGGGCAAACCTTCTACAGGTATTACTCGAGTAATACCTGTAGAAGGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016216.2-2094s1c1
Sequence:CCGGGCCGACAATTTACTTGTCTTACTCGAGTAAGACAAGTAAATTGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016216.2-2384s1c1
Sequence:CCGGGCTATAATATGGGACCATAAACTCGAGTTTATGGTCCCATATTATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016216.2-959s1c1
Sequence:CCGGGCTCCTGATTACTTGGAATATCTCGAGATATTCCAAGTAATCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_016216.2-1714s1c1
Sequence:CCGGGAGGAGGAATCAAGCCATTTACTCGAGTAAATGGCTTGATTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_016216.2-1343s1c1
Sequence:CCGGGAGAGTAATGACTCTGGAGAACTCGAGTTCTCCAGAGTCATTACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016216.2-316s1c1
Sequence:CCGGCATGCAAACCTTCTACAGGTACTCGAGTACCTGTAGAAGGTTTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016216.2-2372s21c1
Sequence:CCGGGCCAAGCACTCTGCTATAATACTCGAGTATTATAGCAGAGTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-1007s21c1
Sequence:CCGGGCTACGGATGATCTTATTAATCTCGAGATTAATAAGATCATCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-779s21c1
Sequence:CCGGGAGCATCTCAAACCTACTTATCTCGAGATAAGTAGGTTTGAGATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016216.2-568s21c1
Sequence:CCGGATCTACAATCAGGAGTATATACTCGAGTATATACTCCTGATTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016216.2-168s21c1
Sequence:CCGGGCGAGCTGGATAAGATCTATGCTCGAGCATAGATCTTATCCAGCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031403
VALIDATED
DBR1 MISSION shRNA Bacterial Glycerol Stock
debranching RNA lariats 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031403.2-1903s1c1
Sequence:CCGGGCTCTGTATTTAGATGTATGTCTCGAGACATACATCTAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031403.2-1301s1c1
Sequence:CCGGGCACCATCAGTGTGGTGAATACTCGAGTATTCACCACACTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031403.2-551s1c1
Sequence:CCGGCCCTTATAATTCATCTACCATCTCGAGATGGTAGATGAATTATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031403.2-1002s1c1
Sequence:CCGGGCCACTGATGACCTGATTAATCTCGAGATTAATCAGGTCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031403.2-1410s1c1
Sequence:CCGGCCAGATGAAATCATGCTGGATCTCGAGATCCAGCATGATTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031403.3-1902s21c1
Sequence:CCGGGCTCTGTATTTAGATGTATGTCTCGAGACATACATCTAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-550s21c1
Sequence:CCGGCCCTTATAATTCATCTACCATCTCGAGATGGTAGATGAATTATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-1300s21c1
Sequence:CCGGGCACCATCAGTGTGGTGAATACTCGAGTATTCACCACACTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-1001s21c1
Sequence:CCGGGCCACTGATGACCTGATTAATCTCGAGATTAATCAGGTCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031403
VALIDATED
DBR1 MISSION shRNA shRNA Plasmid DNA
debranching RNA lariats 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031403.2-1903s1c1
Sequence:CCGGGCTCTGTATTTAGATGTATGTCTCGAGACATACATCTAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031403.2-1301s1c1
Sequence:CCGGGCACCATCAGTGTGGTGAATACTCGAGTATTCACCACACTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031403.2-551s1c1
Sequence:CCGGCCCTTATAATTCATCTACCATCTCGAGATGGTAGATGAATTATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031403.2-1002s1c1
Sequence:CCGGGCCACTGATGACCTGATTAATCTCGAGATTAATCAGGTCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031403.2-1410s1c1
Sequence:CCGGCCAGATGAAATCATGCTGGATCTCGAGATCCAGCATGATTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031403.3-1902s21c1
Sequence:CCGGGCTCTGTATTTAGATGTATGTCTCGAGACATACATCTAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-550s21c1
Sequence:CCGGCCCTTATAATTCATCTACCATCTCGAGATGGTAGATGAATTATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-1300s21c1
Sequence:CCGGGCACCATCAGTGTGGTGAATACTCGAGTATTCACCACACTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-1001s21c1
Sequence:CCGGGCCACTGATGACCTGATTAATCTCGAGATTAATCAGGTCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031403
VALIDATED
DBR1 MISSION shRNA Lentiviral Transduction Particles
debranching RNA lariats 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119567    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031403.2-1903s1c1
Sequence:CCGGGCTCTGTATTTAGATGTATGTCTCGAGACATACATCTAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031403.2-1301s1c1
Sequence:CCGGGCACCATCAGTGTGGTGAATACTCGAGTATTCACCACACTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031403.2-551s1c1
Sequence:CCGGCCCTTATAATTCATCTACCATCTCGAGATGGTAGATGAATTATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031403.2-1002s1c1
Sequence:CCGGGCCACTGATGACCTGATTAATCTCGAGATTAATCAGGTCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031403.2-1410s1c1
Sequence:CCGGCCAGATGAAATCATGCTGGATCTCGAGATCCAGCATGATTTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031403.3-1902s21c1
Sequence:CCGGGCTCTGTATTTAGATGTATGTCTCGAGACATACATCTAAATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-550s21c1
Sequence:CCGGCCCTTATAATTCATCTACCATCTCGAGATGGTAGATGAATTATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-1300s21c1
Sequence:CCGGGCACCATCAGTGTGGTGAATACTCGAGTATTCACCACACTGATGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031403.3-1001s21c1
Sequence:CCGGGCCACTGATGACCTGATTAATCTCGAGATTAATCAGGTCATCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks