EMAIL THIS PAGE TO A FRIEND

DBT

dihydrolipoamide branched chain transacylase E2

119 Gene Product Result for
Synonyms: BCATE2 BCKAD-E2 BCKADE2 E2 E2B
UniProtKB ID: P11182, B2R811, Q5VVL8
Gene ID:
Human(1629) Summary: The branched-chain alpha-keto acid dehydrogenase complex (BCKD) is an inner-mitochondrial enzyme complex involved in the breakdown of the branched-chain amino acids isoleucine, leucine, and valine. The BCKD complex is thought to be composed of a core of 24 transacylase (E2) subunits, and associated decarboxylase (E1), dehydrogenase (E3), and regulatory subunits. This gene encodes the transacylase (E2) subunit. Mutations in this gene result in maple syrup urine disease, type 2. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(13171) dihydrolipoamide branched chain transacylase E2
Rat(29611) dihydrolipoamide branched chain transacylase E2
sheep(101120981) dihydrolipoamide branched chain transacylase E2
Domestic Rabbit(100346987) dihydrolipoamide branched chain transacylase E2
domestic guinea pig(100731247) dihydrolipoamide branched chain transacylase E2
naked mole-rat(101722423) dihydrolipoamide branched chain transacylase E2
Zebrafish(541388) dihydrolipoamide branched chain transacylase E2
chicken(395374) dihydrolipoamide branched chain transacylase E2
dog(479929) dihydrolipoamide branched chain transacylase E2
Horse(100050317) dihydrolipoamide branched chain transacylase E2
cow(280759) dihydrolipoamide branched chain transacylase E2
domestic cat(101087593) dihydrolipoamide branched chain transacylase E2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010022 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010022 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010022 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001918 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001918 Rosetta Predictions human pricing
NM_053312 Rosetta Predictions rat pricing
NM_010022 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185789 predicted 1113
2 SASI_Hs01_00185790 predicted 1089
3 SASI_Hs01_00185792 predicted 591
4 SASI_Hs02_00332802 predicted 934
5 SASI_Hs01_00185794 predicted 583
6 SASI_Hs01_00185795 predicted 237
7 SASI_Hs01_00185796 predicted 1386
8 SASI_Hs01_00185797 predicted 266
9 SASI_Hs02_00332803 predicted 1460
10 SASI_Hs02_00332804 predicted 360
11 SASI_Hs01_00185791 predicted 416
12 SASI_Hs01_00185793 predicted 234
13 SASI_Hs01_00185798 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053312 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265724 predicted 593
2 SASI_Rn02_00265725 predicted 566
3 SASI_Rn02_00265726 predicted 254
4 SASI_Rn02_00265727 predicted 1370
5 SASI_Rn02_00265728 predicted 1193
6 SASI_Rn02_00265729 predicted 1219
7 SASI_Rn02_00265730 predicted 1365
8 SASI_Rn02_00265731 predicted 1322
9 SASI_Rn02_00265732 predicted 1408
10 SASI_Rn02_00265733 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010022 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317646 predicted 1241
2 SASI_Mm02_00317647 predicted 284
3 SASI_Mm02_00317648 predicted 1437
4 SASI_Mm02_00317649 predicted 623
5 SASI_Mm02_00317650 predicted 421
6 SASI_Mm02_00317651 predicted 1352
7 SASI_Mm02_00317652 predicted 606
8 SASI_Mm02_00317653 predicted 1226
9 SASI_Mm02_00317654 predicted 1365
10 SASI_Mm02_00317655 predicted 1229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010022
VALIDATED
DBT MISSION shRNA Bacterial Glycerol Stock
dihydrolipoamide branched chain transacylase E2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-962s21c1
Sequence:CCGGGCGTGGAATCAAACTCTCCTTCTCGAGAAGGAGAGTTTGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010022.3-1592s21c1
Sequence:CCGGCGGCTGCATTAGAAATGGTTTCTCGAGAAACCATTTCTAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-397s21c1
Sequence:CCGGGCCGTTACGATGGCGTCATTACTCGAGTAATGACGCCATCGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-1360s21c1
Sequence:CCGGACCAGAAAGGAGACGTTTATACTCGAGTATAAACGTCTCCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-1080s21c1
Sequence:CCGGGCTTCTCACAACATTGGGATACTCGAGTATCCCAATGTTGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010022.1-1545s1c1
Sequence:CCGGCGGCTGCATTAGAAATGGTTTCTCGAGAAACCATTTCTAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-1400s1c1
Sequence:CCGGGCTTCTCTAATTTGTGGAAATCTCGAGATTTCCACAAATTAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010022.1-1033s1c1
Sequence:CCGGGCTTCTCACAACATTGGGATACTCGAGTATCCCAATGTTGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-363s1c1
Sequence:CCGGCGTCATTAAGAGGCTCTATTACTCGAGTAATAGAGCCTCTTAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-915s1c1
Sequence:CCGGGCGTGGAATCAAACTCTCCTTCTCGAGAAGGAGAGTTTGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010022
VALIDATED
DBT MISSION shRNA shRNA Plasmid DNA
dihydrolipoamide branched chain transacylase E2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-962s21c1
Sequence:CCGGGCGTGGAATCAAACTCTCCTTCTCGAGAAGGAGAGTTTGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010022.3-1592s21c1
Sequence:CCGGCGGCTGCATTAGAAATGGTTTCTCGAGAAACCATTTCTAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-397s21c1
Sequence:CCGGGCCGTTACGATGGCGTCATTACTCGAGTAATGACGCCATCGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-1360s21c1
Sequence:CCGGACCAGAAAGGAGACGTTTATACTCGAGTATAAACGTCTCCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-1080s21c1
Sequence:CCGGGCTTCTCACAACATTGGGATACTCGAGTATCCCAATGTTGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010022.1-1545s1c1
Sequence:CCGGCGGCTGCATTAGAAATGGTTTCTCGAGAAACCATTTCTAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-1400s1c1
Sequence:CCGGGCTTCTCTAATTTGTGGAAATCTCGAGATTTCCACAAATTAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010022.1-1033s1c1
Sequence:CCGGGCTTCTCACAACATTGGGATACTCGAGTATCCCAATGTTGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-363s1c1
Sequence:CCGGCGTCATTAAGAGGCTCTATTACTCGAGTAATAGAGCCTCTTAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-915s1c1
Sequence:CCGGGCGTGGAATCAAACTCTCCTTCTCGAGAAGGAGAGTTTGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010022
VALIDATED
DBT MISSION shRNA Lentiviral Transduction Particles
dihydrolipoamide branched chain transacylase E2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-962s21c1
Sequence:CCGGGCGTGGAATCAAACTCTCCTTCTCGAGAAGGAGAGTTTGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317068    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010022.3-1592s21c1
Sequence:CCGGCGGCTGCATTAGAAATGGTTTCTCGAGAAACCATTTCTAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-397s21c1
Sequence:CCGGGCCGTTACGATGGCGTCATTACTCGAGTAATGACGCCATCGTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-1360s21c1
Sequence:CCGGACCAGAAAGGAGACGTTTATACTCGAGTATAAACGTCTCCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010022.3-1080s21c1
Sequence:CCGGGCTTCTCACAACATTGGGATACTCGAGTATCCCAATGTTGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099375    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010022.1-1545s1c1
Sequence:CCGGCGGCTGCATTAGAAATGGTTTCTCGAGAAACCATTTCTAATGCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-1400s1c1
Sequence:CCGGGCTTCTCTAATTTGTGGAAATCTCGAGATTTCCACAAATTAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010022.1-1033s1c1
Sequence:CCGGGCTTCTCACAACATTGGGATACTCGAGTATCCCAATGTTGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-363s1c1
Sequence:CCGGCGTCATTAAGAGGCTCTATTACTCGAGTAATAGAGCCTCTTAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010022.1-915s1c1
Sequence:CCGGGCGTGGAATCAAACTCTCCTTCTCGAGAAGGAGAGTTTGATTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001918
VALIDATED
DBT MISSION shRNA Bacterial Glycerol Stock
dihydrolipoamide branched chain transacylase E2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-522s21c1
Sequence:CCGGCCAAGAGATAAAGGGCCGAAACTCGAGTTTCGGCCCTTTATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-1264s21c1
Sequence:CCGGCCAGTGATAATGCCACCTGAACTCGAGTTCAGGTGGCATTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-973s21c1
Sequence:CCGGGCTGCTTCCTTGGGATTACTACTCGAGTAGTAATCCCAAGGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-160s21c1
Sequence:CCGGCCTTCATTCAAGTATAGTCATCTCGAGATGACTATACTTGAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-1245s1c1
Sequence:CCGGCCAGTGATAATGCCACCTGAACTCGAGTTCAGGTGGCATTATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-954s1c1
Sequence:CCGGGCTGCTTCCTTGGGATTACTACTCGAGTAGTAATCCCAAGGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001918.1-1067s1c1
Sequence:CCGGGCAGGGTTTGATTGTCCCTAACTCGAGTTAGGGACAATCAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-503s1c1
Sequence:CCGGCCAAGAGATAAAGGGCCGAAACTCGAGTTTCGGCCCTTTATCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-141s1c1
Sequence:CCGGCCTTCATTCAAGTATAGTCATCTCGAGATGACTATACTTGAATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001918
VALIDATED
DBT MISSION shRNA shRNA Plasmid DNA
dihydrolipoamide branched chain transacylase E2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-522s21c1
Sequence:CCGGCCAAGAGATAAAGGGCCGAAACTCGAGTTTCGGCCCTTTATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-1264s21c1
Sequence:CCGGCCAGTGATAATGCCACCTGAACTCGAGTTCAGGTGGCATTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-973s21c1
Sequence:CCGGGCTGCTTCCTTGGGATTACTACTCGAGTAGTAATCCCAAGGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-160s21c1
Sequence:CCGGCCTTCATTCAAGTATAGTCATCTCGAGATGACTATACTTGAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-1245s1c1
Sequence:CCGGCCAGTGATAATGCCACCTGAACTCGAGTTCAGGTGGCATTATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-954s1c1
Sequence:CCGGGCTGCTTCCTTGGGATTACTACTCGAGTAGTAATCCCAAGGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001918.1-1067s1c1
Sequence:CCGGGCAGGGTTTGATTGTCCCTAACTCGAGTTAGGGACAATCAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-503s1c1
Sequence:CCGGCCAAGAGATAAAGGGCCGAAACTCGAGTTTCGGCCCTTTATCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-141s1c1
Sequence:CCGGCCTTCATTCAAGTATAGTCATCTCGAGATGACTATACTTGAATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001918
VALIDATED
DBT MISSION shRNA Lentiviral Transduction Particles
dihydrolipoamide branched chain transacylase E2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-522s21c1
Sequence:CCGGCCAAGAGATAAAGGGCCGAAACTCGAGTTTCGGCCCTTTATCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-1264s21c1
Sequence:CCGGCCAGTGATAATGCCACCTGAACTCGAGTTCAGGTGGCATTATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-973s21c1
Sequence:CCGGGCTGCTTCCTTGGGATTACTACTCGAGTAGTAATCCCAAGGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001918.2-160s21c1
Sequence:CCGGCCTTCATTCAAGTATAGTCATCTCGAGATGACTATACTTGAATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-1245s1c1
Sequence:CCGGCCAGTGATAATGCCACCTGAACTCGAGTTCAGGTGGCATTATCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-954s1c1
Sequence:CCGGGCTGCTTCCTTGGGATTACTACTCGAGTAGTAATCCCAAGGAAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001918.1-1067s1c1
Sequence:CCGGGCAGGGTTTGATTGTCCCTAACTCGAGTTAGGGACAATCAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-503s1c1
Sequence:CCGGCCAAGAGATAAAGGGCCGAAACTCGAGTTTCGGCCCTTTATCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001918.1-141s1c1
Sequence:CCGGCCTTCATTCAAGTATAGTCATCTCGAGATGACTATACTTGAATGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks