EMAIL THIS PAGE TO A FRIEND

DBX1

developing brain homeobox 1

45 Gene Product Result for
UniProtKB ID: A6NMT0
Gene ID:
Mouse(13172) developing brain homeobox 1
Rat(292934) developing brain homeobox 1
chicken(422976) developing brain homeobox 1
domestic cat(101084224) developing brain homeobox 1
dog(485412) developing brain homeobox 1
cow(517514) developing brain homeobox 1
sheep(101115239) developing brain homeobox 1
naked mole-rat(101724327) developing brain homeobox 1
domestic guinea pig(100723226) developing brain homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_061930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_061930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_061930 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU014771 MISSION® esiRNA esiRNA targeting mouse Dbx1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029865 Rosetta Predictions human pricing
NM_001009644 Rosetta Predictions rat pricing
NM_001005232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059446 predicted 650
2 SASI_Hs01_00059447 predicted 809
3 SASI_Hs01_00059449 predicted 327
4 SASI_Hs01_00059450 predicted 397
5 SASI_Hs01_00059451 predicted 367
6 SASI_Hs02_00307543 predicted 542
7 SASI_Hs01_00059452 predicted 308
8 SASI_Hs01_00059453 predicted 874
9 SASI_Hs01_00059454 predicted 625
10 SASI_Hs01_00059455 predicted 817
11 SASI_Hs01_00059448 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009644 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030278 predicted 476
2 SASI_Rn01_00030279 predicted 636
3 SASI_Rn01_00030280 predicted 336
4 SASI_Rn01_00030281 predicted 691
5 SASI_Rn01_00030282 predicted 403
6 SASI_Rn02_00199665 predicted 775
7 SASI_Rn01_00030283 predicted 610
8 SASI_Rn02_00199666 predicted 426
9 SASI_Rn01_00030285 predicted 752
10 SASI_Rn02_00199667 predicted 583
11 SASI_Rn01_00030284 predicted 553
12 SASI_Rn01_00030286 predicted 364
13 SASI_Rn01_00030287 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086131 predicted 1345
2 SASI_Mm01_00086132 predicted 222
3 SASI_Mm01_00086133 predicted 559
4 SASI_Mm01_00086134 predicted 1607
5 SASI_Mm01_00086135 predicted 222
6 SASI_Mm01_00086136 predicted 1147
7 SASI_Mm01_00086137 predicted 1363
8 SASI_Mm01_00086138 predicted 1543
9 SASI_Mm01_00086139 predicted 557
10 SASI_Mm01_00086140 predicted 552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005232
DBX1 MISSION shRNA Bacterial Glycerol Stock
developing brain homeobox 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-199s1c1
Sequence:CCGGCAGTCCCTTCAATCCGCATTTCTCGAGAAATGCGGATTGAAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005232.1-1663s1c1
Sequence:CCGGGCGATTTCTCTCTGTAGACATCTCGAGATGTCTACAGAGAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-226s1c1
Sequence:CCGGCACTCTAGTTTCCTAGTAGAACTCGAGTTCTACTAGGAAACTAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-563s1c1
Sequence:CCGGCCTTTATCAGATCCTCCTATTCTCGAGAATAGGAGGATCTGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-1050s1c1
Sequence:CCGGCCCGGGTAAACCGTCAGACTTCTCGAGAAGTCTGACGGTTTACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005232
DBX1 MISSION shRNA shRNA Plasmid DNA
developing brain homeobox 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-199s1c1
Sequence:CCGGCAGTCCCTTCAATCCGCATTTCTCGAGAAATGCGGATTGAAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005232.1-1663s1c1
Sequence:CCGGGCGATTTCTCTCTGTAGACATCTCGAGATGTCTACAGAGAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-226s1c1
Sequence:CCGGCACTCTAGTTTCCTAGTAGAACTCGAGTTCTACTAGGAAACTAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-563s1c1
Sequence:CCGGCCTTTATCAGATCCTCCTATTCTCGAGAATAGGAGGATCTGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-1050s1c1
Sequence:CCGGCCCGGGTAAACCGTCAGACTTCTCGAGAAGTCTGACGGTTTACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005232
DBX1 MISSION shRNA Lentiviral Transduction Particles
developing brain homeobox 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-199s1c1
Sequence:CCGGCAGTCCCTTCAATCCGCATTTCTCGAGAAATGCGGATTGAAGGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005232.1-1663s1c1
Sequence:CCGGGCGATTTCTCTCTGTAGACATCTCGAGATGTCTACAGAGAGAAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-226s1c1
Sequence:CCGGCACTCTAGTTTCCTAGTAGAACTCGAGTTCTACTAGGAAACTAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-563s1c1
Sequence:CCGGCCTTTATCAGATCCTCCTATTCTCGAGAATAGGAGGATCTGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005232.1-1050s1c1
Sequence:CCGGCCCGGGTAAACCGTCAGACTTCTCGAGAAGTCTGACGGTTTACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_061930
DBX1 MISSION shRNA Bacterial Glycerol Stock
developing brain homeobox 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000016833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-415s1c1
Sequence:CCGGGAGAACTTTGTTGAACTTCATCTCGAGATGAAGTTCAACAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-892s1c1
Sequence:CCGGCCTTTCATCAGATCTTCTTATCTCGAGATAAGAAGATCTGATGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-529s1c1
Sequence:CCGGCAATCCTTGCAGTCGGCATTTCTCGAGAAATGCCGACTGCAAGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-89s1c1
Sequence:CCGGTGGCTTCAAGTTCTTACCGTTCTCGAGAACGGTAAGAACTTGAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_061930
DBX1 MISSION shRNA shRNA Plasmid DNA
developing brain homeobox 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000016833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-415s1c1
Sequence:CCGGGAGAACTTTGTTGAACTTCATCTCGAGATGAAGTTCAACAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-892s1c1
Sequence:CCGGCCTTTCATCAGATCTTCTTATCTCGAGATAAGAAGATCTGATGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-529s1c1
Sequence:CCGGCAATCCTTGCAGTCGGCATTTCTCGAGAAATGCCGACTGCAAGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-89s1c1
Sequence:CCGGTGGCTTCAAGTTCTTACCGTTCTCGAGAACGGTAAGAACTTGAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_061930
DBX1 MISSION shRNA Lentiviral Transduction Particles
developing brain homeobox 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000016833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-415s1c1
Sequence:CCGGGAGAACTTTGTTGAACTTCATCTCGAGATGAAGTTCAACAAAGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-892s1c1
Sequence:CCGGCCTTTCATCAGATCTTCTTATCTCGAGATAAGAAGATCTGATGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-529s1c1
Sequence:CCGGCAATCCTTGCAGTCGGCATTTCTCGAGAAATGCCGACTGCAAGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_061930.6-89s1c1
Sequence:CCGGTGGCTTCAAGTTCTTACCGTTCTCGAGAACGGTAAGAACTTGAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks