EMAIL THIS PAGE TO A FRIEND

DBX2

developing brain homeobox 2

137 Gene Product Result for
UniProtKB ID: Q6ZNG2
Gene ID:
Mouse(223843) developing brain homeobox 2
Rat(541457) developing brain homeobox 2
Zebrafish(30417) developing brain homeobox 2
dog(486598) developing brain homeobox 2
cow(510669) developing brain homeobox 2
domestic cat(101081816) developing brain homeobox 2
chicken(417801) developing brain homeobox 2
domestic guinea pig(100728913) developing brain homeobox 2
naked mole-rat(101725363) developing brain homeobox 2
sheep(101113223) developing brain homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004329 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004329 Rosetta Predictions human pricing
XM_001053826 Rosetta Predictions rat pricing
XM_001058743 Rosetta Predictions rat pricing
NM_207533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304546 predicted 1176
2 SASI_Hs01_00065210 predicted 839
3 SASI_Hs01_00065211 predicted 1033
4 SASI_Hs01_00065212 predicted 825
5 SASI_Hs01_00065214 predicted 934
6 SASI_Hs01_00065216 predicted 1121
7 SASI_Hs01_00065218 predicted 908
8 SASI_Hs01_00065219 predicted 1040
9 SASI_Hs02_00304547 predicted 1012
10 SASI_Hs02_00304548 predicted 1063
11 SASI_Hs01_00065213 predicted 1118
12 SASI_Hs01_00065215 predicted 643
13 SASI_Hs01_00065217 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273715 predicted 293
2 SASI_Rn02_00273716 predicted 210
3 SASI_Rn02_00273717 predicted 222
4 SASI_Rn02_00273718 predicted 261
5 SASI_Rn02_00273719 predicted 275
6 SASI_Rn02_00273720 predicted 367
7 SASI_Rn02_00273721 predicted 237
8 SASI_Rn02_00273722 predicted 409
9 SASI_Rn02_00273723 predicted 286
10 SASI_Rn02_00273724 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290737 predicted 1112
2 SASI_Rn02_00290738 predicted 692
3 SASI_Rn02_00290739 predicted 842
4 SASI_Rn02_00290740 predicted 780
5 SASI_Rn02_00290741 predicted 1203
6 SASI_Rn02_00290742 predicted 813
7 SASI_Rn02_00290743 predicted 1239
8 SASI_Rn02_00290744 predicted 1173
9 SASI_Rn02_00290745 predicted 710
10 SASI_Rn02_00290746 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352076 predicted 1003
2 SASI_Mm02_00352077 predicted 1174
3 SASI_Mm02_00352078 predicted 1142
4 SASI_Mm02_00352079 predicted 957
5 SASI_Mm02_00352080 predicted 836
6 SASI_Mm02_00352081 predicted 1070
7 SASI_Mm02_00352082 predicted 1173
8 SASI_Mm02_00352083 predicted 1235
9 SASI_Mm02_00352084 predicted 875
10 SASI_Mm02_00352085 predicted 873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004329
DBX2 MISSION shRNA Bacterial Glycerol Stock
developing brain homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004329.1-2345s1c1
Sequence:CCGGGCCGAGTTAATCCAGAAGTTTCTCGAGAAACTTCTGGATTAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-827s1c1
Sequence:CCGGCTTGCCATCAACTTGGGACTACTCGAGTAGTCCCAAGTTGATGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-692s1c1
Sequence:CCGGCTCCTGACACAGGACTCTAATCTCGAGATTAGAGTCCTGTGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-280s1c1
Sequence:CCGGGAGTTTCCTGATCGAGAATTTCTCGAGAAATTCTCGATCAGGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-1119s1c1
Sequence:CCGGCACTGCAAGGTGCCTTATATTCTCGAGAATATAAGGCACCTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004329
DBX2 MISSION shRNA shRNA Plasmid DNA
developing brain homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004329.1-2345s1c1
Sequence:CCGGGCCGAGTTAATCCAGAAGTTTCTCGAGAAACTTCTGGATTAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-827s1c1
Sequence:CCGGCTTGCCATCAACTTGGGACTACTCGAGTAGTCCCAAGTTGATGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-692s1c1
Sequence:CCGGCTCCTGACACAGGACTCTAATCTCGAGATTAGAGTCCTGTGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-280s1c1
Sequence:CCGGGAGTTTCCTGATCGAGAATTTCTCGAGAAATTCTCGATCAGGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-1119s1c1
Sequence:CCGGCACTGCAAGGTGCCTTATATTCTCGAGAATATAAGGCACCTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004329
DBX2 MISSION shRNA Lentiviral Transduction Particles
developing brain homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004329.1-2345s1c1
Sequence:CCGGGCCGAGTTAATCCAGAAGTTTCTCGAGAAACTTCTGGATTAACTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-827s1c1
Sequence:CCGGCTTGCCATCAACTTGGGACTACTCGAGTAGTCCCAAGTTGATGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-692s1c1
Sequence:CCGGCTCCTGACACAGGACTCTAATCTCGAGATTAGAGTCCTGTGTCAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-280s1c1
Sequence:CCGGGAGTTTCCTGATCGAGAATTTCTCGAGAAATTCTCGATCAGGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004329.1-1119s1c1
Sequence:CCGGCACTGCAAGGTGCCTTATATTCTCGAGAATATAAGGCACCTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207533
DBX2 MISSION shRNA Bacterial Glycerol Stock
developing brain homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207533.2-1924s21c1
Sequence:CCGGTCGTCTGCACCAACGAGTTTACTCGAGTAAACTCGTTGGTGCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-807s21c1
Sequence:CCGGGGAGTCACAGGTGAAGATTTGCTCGAGCAAATCTTCACCTGTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-947s21c1
Sequence:CCGGCTCCGCAGTGCCCGTCAATATCTCGAGATATTGACGGGCACTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-1121s21c1
Sequence:CCGGATGGACTCCAGAGCACCATTTCTCGAGAAATGGTGCTCTGGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-650s21c1
Sequence:CCGGTGCTGACCCAGGACTCAAATTCTCGAGAATTTGAGTCCTGGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207533
DBX2 MISSION shRNA shRNA Plasmid DNA
developing brain homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207533.2-1924s21c1
Sequence:CCGGTCGTCTGCACCAACGAGTTTACTCGAGTAAACTCGTTGGTGCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-807s21c1
Sequence:CCGGGGAGTCACAGGTGAAGATTTGCTCGAGCAAATCTTCACCTGTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-947s21c1
Sequence:CCGGCTCCGCAGTGCCCGTCAATATCTCGAGATATTGACGGGCACTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-1121s21c1
Sequence:CCGGATGGACTCCAGAGCACCATTTCTCGAGAAATGGTGCTCTGGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-650s21c1
Sequence:CCGGTGCTGACCCAGGACTCAAATTCTCGAGAATTTGAGTCCTGGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207533
DBX2 MISSION shRNA Lentiviral Transduction Particles
developing brain homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207533.2-1924s21c1
Sequence:CCGGTCGTCTGCACCAACGAGTTTACTCGAGTAAACTCGTTGGTGCAGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-807s21c1
Sequence:CCGGGGAGTCACAGGTGAAGATTTGCTCGAGCAAATCTTCACCTGTGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-947s21c1
Sequence:CCGGCTCCGCAGTGCCCGTCAATATCTCGAGATATTGACGGGCACTGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-1121s21c1
Sequence:CCGGATGGACTCCAGAGCACCATTTCTCGAGAAATGGTGCTCTGGAGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207533.2-650s21c1
Sequence:CCGGTGCTGACCCAGGACTCAAATTCTCGAGAATTTGAGTCCTGGGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks