EMAIL THIS PAGE TO A FRIEND

DCAF10

DDB1 and CUL4 associated factor 10

160 Gene Product Result for
Synonyms: WDR32
Gene ID:
Mouse(242418) DDB1 and CUL4 associated factor 10
Rat(313242) DDB1 and CUL4 associated factor 10
chicken(426804) DDB1 and CUL4 associated factor 10
cow(509776) DDB1 and CUL4 associated factor 10
domestic cat(101081335) DDB1 and CUL4 associated factor 10
dog(481617) DDB1 and CUL4 associated factor 10
sheep(101105805) DDB1 and CUL4 associated factor 10
naked mole-rat(101702858) DDB1 and CUL4 associated factor 10
domestic guinea pig(100714765) DDB1 and CUL4 associated factor 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024345 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024345 Rosetta Predictions human pricing
NM_001107935 Rosetta Predictions rat pricing
NM_153167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209830 predicted 865
2 SASI_Hs01_00209831 predicted 930
3 SASI_Hs01_00209833 predicted 1104
4 SASI_Hs01_00209834 predicted 1571
5 SASI_Hs01_00209835 predicted 1647
6 SASI_Hs01_00209836 predicted 1073
7 SASI_Hs02_00356703 predicted 1793
8 SASI_Hs01_00209838 predicted 1060
9 SASI_Hs01_00209839 predicted 1240
10 SASI_Hs02_00356704 predicted 576
11 SASI_Hs01_00209832 predicted 1306
12 SASI_Hs01_00209837 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233735 predicted 834
2 SASI_Rn02_00233736 predicted 811
3 SASI_Rn02_00233737 predicted 1772
4 SASI_Rn02_00233738 predicted 1075
5 SASI_Rn02_00233739 predicted 484
6 SASI_Rn02_00233740 predicted 950
7 SASI_Rn02_00233741 predicted 888
8 SASI_Rn02_00233742 predicted 1060
9 SASI_Rn02_00233743 predicted 1537
10 SASI_Rn02_00233744 predicted 1592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343077 predicted 881
2 SASI_Mm02_00343078 predicted 1820
3 SASI_Mm02_00343079 predicted 1124
4 SASI_Mm02_00343080 predicted 1082
5 SASI_Mm02_00343081 predicted 1073
6 SASI_Mm02_00343082 predicted 944
7 SASI_Mm02_00343083 predicted 999
8 SASI_Mm02_00343084 predicted 718
9 SASI_Mm02_00343085 predicted 1636
10 SASI_Mm02_00343086 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153167
VALIDATED
DCAF10 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 10
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-778s21c1
Sequence:CCGGTGATACCACAATAGCACTATGCTCGAGCATAGTGCTATTGTGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-852s21c1
Sequence:CCGGGGGTGAAGAACATCGAATATGCTCGAGCATATTCGATGTTCTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-1252s21c1
Sequence:CCGGAGGAGTTTCACCACGAAATAGCTCGAGCTATTTCGTGGTGAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153167.2-4002s21c1
Sequence:CCGGTAGGTGGAATGAGCGTCAAATCTCGAGATTTGACGCTCATTCCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153167.1-1029s1c1
Sequence:CCGGGCTGGACTTAACTAAGTCTTTCTCGAGAAAGACTTAGTTAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153167.1-1567s1c1
Sequence:CCGGCTTGTTGACTGTTTACCCAAACTCGAGTTTGGGTAAACAGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153167
VALIDATED
DCAF10 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 10
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-778s21c1
Sequence:CCGGTGATACCACAATAGCACTATGCTCGAGCATAGTGCTATTGTGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-852s21c1
Sequence:CCGGGGGTGAAGAACATCGAATATGCTCGAGCATATTCGATGTTCTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-1252s21c1
Sequence:CCGGAGGAGTTTCACCACGAAATAGCTCGAGCTATTTCGTGGTGAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153167.2-4002s21c1
Sequence:CCGGTAGGTGGAATGAGCGTCAAATCTCGAGATTTGACGCTCATTCCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153167.1-1029s1c1
Sequence:CCGGGCTGGACTTAACTAAGTCTTTCTCGAGAAAGACTTAGTTAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153167.1-1567s1c1
Sequence:CCGGCTTGTTGACTGTTTACCCAAACTCGAGTTTGGGTAAACAGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153167
VALIDATED
DCAF10 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 10
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-778s21c1
Sequence:CCGGTGATACCACAATAGCACTATGCTCGAGCATAGTGCTATTGTGGTATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-852s21c1
Sequence:CCGGGGGTGAAGAACATCGAATATGCTCGAGCATATTCGATGTTCTTCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153167.2-1252s21c1
Sequence:CCGGAGGAGTTTCACCACGAAATAGCTCGAGCTATTTCGTGGTGAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153167.2-4002s21c1
Sequence:CCGGTAGGTGGAATGAGCGTCAAATCTCGAGATTTGACGCTCATTCCACCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175797    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153167.1-1029s1c1
Sequence:CCGGGCTGGACTTAACTAAGTCTTTCTCGAGAAAGACTTAGTTAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153167.1-1567s1c1
Sequence:CCGGCTTGTTGACTGTTTACCCAAACTCGAGTTTGGGTAAACAGTCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024345
VALIDATED
DCAF10 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-510s1c1
Sequence:CCGGGATTTCAACGTCCTCTGGATACTCGAGTATCCAGAGGACGTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-596s1c1
Sequence:CCGGGAGCAAGAAGAACTACTTCAACTCGAGTTGAAGTAGTTCTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-943s1c1
Sequence:CCGGCTACGACTGACTCATTACATTCTCGAGAATGTAATGAGTCAGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-115s1c1
Sequence:CCGGCTGACAGTTGCTTGTGAACAACTCGAGTTGTTCACAAGCAACTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024345.2-2361s1c1
Sequence:CCGGGCTGATATGAAGACTTGCCTTCTCGAGAAGGCAAGTCTTCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-1013s1c1
Sequence:CCGGCCGATGGACGAATGATTTCTTCTCGAGAAGAAATCATTCGTCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024345.2-475s1c1
Sequence:CCGGCGAATGAGGTTAACACCAGATCTCGAGATCTGGTGTTAACCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-1209s1c1
Sequence:CCGGCCTTAGTGGACGGGTTTCTTTCTCGAGAAAGAAACCCGTCCACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-365s1c1
Sequence:CCGGGACTCTTAGTAACATCAGGATCTCGAGATCCTGATGTTACTAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024345
VALIDATED
DCAF10 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-510s1c1
Sequence:CCGGGATTTCAACGTCCTCTGGATACTCGAGTATCCAGAGGACGTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-596s1c1
Sequence:CCGGGAGCAAGAAGAACTACTTCAACTCGAGTTGAAGTAGTTCTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-943s1c1
Sequence:CCGGCTACGACTGACTCATTACATTCTCGAGAATGTAATGAGTCAGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-115s1c1
Sequence:CCGGCTGACAGTTGCTTGTGAACAACTCGAGTTGTTCACAAGCAACTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024345.2-2361s1c1
Sequence:CCGGGCTGATATGAAGACTTGCCTTCTCGAGAAGGCAAGTCTTCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-1013s1c1
Sequence:CCGGCCGATGGACGAATGATTTCTTCTCGAGAAGAAATCATTCGTCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024345.2-475s1c1
Sequence:CCGGCGAATGAGGTTAACACCAGATCTCGAGATCTGGTGTTAACCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-1209s1c1
Sequence:CCGGCCTTAGTGGACGGGTTTCTTTCTCGAGAAAGAAACCCGTCCACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-365s1c1
Sequence:CCGGGACTCTTAGTAACATCAGGATCTCGAGATCCTGATGTTACTAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024345
VALIDATED
DCAF10 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-510s1c1
Sequence:CCGGGATTTCAACGTCCTCTGGATACTCGAGTATCCAGAGGACGTTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-596s1c1
Sequence:CCGGGAGCAAGAAGAACTACTTCAACTCGAGTTGAAGTAGTTCTTCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-943s1c1
Sequence:CCGGCTACGACTGACTCATTACATTCTCGAGAATGTAATGAGTCAGTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-115s1c1
Sequence:CCGGCTGACAGTTGCTTGTGAACAACTCGAGTTGTTCACAAGCAACTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128959    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024345.2-2361s1c1
Sequence:CCGGGCTGATATGAAGACTTGCCTTCTCGAGAAGGCAAGTCTTCATATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-1013s1c1
Sequence:CCGGCCGATGGACGAATGATTTCTTCTCGAGAAGAAATCATTCGTCCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_024345.2-475s1c1
Sequence:CCGGCGAATGAGGTTAACACCAGATCTCGAGATCTGGTGTTAACCTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129591    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024345.2-1209s1c1
Sequence:CCGGCCTTAGTGGACGGGTTTCTTTCTCGAGAAAGAAACCCGTCCACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024345.2-365s1c1
Sequence:CCGGGACTCTTAGTAACATCAGGATCTCGAGATCCTGATGTTACTAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks