EMAIL THIS PAGE TO A FRIEND

DCAF11

DDB1 and CUL4 associated factor 11

Synonyms: PRO2389 WDR23
Gene ID:
Human(80344) Summary: This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Mouse(28199) DDB1 and CUL4 associated factor 11
Rat(305895) DDB1 and CUL4 associated factor 11
domestic guinea pig(100714230) DDB1 and CUL4 associated factor 11
naked mole-rat(101704427) DDB1 and CUL4 associated factor 11
sheep(101117933) DDB1 and CUL4 associated factor 11
Zebrafish(567578) ddb1 and cul4 associated factor 11
cow(539433) DDB1 and CUL4 associated factor 11
domestic cat(101099129) DDB1 and CUL4 associated factor 11
dog(490621) DDB1 and CUL4 associated factor 11
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025230 Rosetta Predictions human pricing
NM_181357 Rosetta Predictions human pricing
NM_001009686 Rosetta Predictions rat pricing
NM_133734 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137081 predicted 1292
2 SASI_Hs01_00137082 predicted 1825
3 SASI_Hs01_00137083 predicted 2347
4 SASI_Hs01_00137084 predicted 1553
5 SASI_Hs01_00137086 predicted 2096
6 SASI_Hs01_00137087 predicted 1276
7 SASI_Hs01_00137088 predicted 1596
8 SASI_Hs02_00358041 predicted 1540
9 SASI_Hs01_00137089 predicted 1427
10 SASI_Hs02_00358042 predicted 1191
11 SASI_Hs01_00137085 predicted 1542
12 SASI_Hs01_00137090 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117708 predicted 1216
2 SASI_Hs01_00117709 predicted 1747
3 SASI_Hs01_00117710 predicted 2274
4 SASI_Hs01_00117711 predicted 1480
5 SASI_Hs01_00117713 predicted 2017
6 SASI_Hs01_00117714 predicted 1200
7 SASI_Hs01_00117715 predicted 1516
8 SASI_Hs02_00370025 predicted 1462
9 SASI_Hs01_00117716 predicted 1345
10 SASI_Hs02_00370026 predicted 1119
11 SASI_Hs01_00117712 predicted 1470
12 SASI_Hs01_00117717 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009686 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070330 predicted 1657
2 SASI_Rn01_00070331 predicted 1931
3 SASI_Rn01_00070332 predicted 732
4 SASI_Rn01_00070333 predicted 1073
5 SASI_Rn01_00070334 predicted 1122
6 SASI_Rn01_00070335 predicted 1030
7 SASI_Rn01_00070336 predicted 1104
8 SASI_Rn01_00070337 predicted 847
9 SASI_Rn01_00070338 predicted 1567
10 SASI_Rn01_00070339 predicted 1091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133734 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047604 predicted 1839
2 SASI_Mm01_00047605 predicted 638
3 SASI_Mm01_00047606 predicted 985
4 SASI_Mm01_00047607 predicted 1158
5 SASI_Mm01_00047608 predicted 1035
6 SASI_Mm01_00047609 predicted 1750
7 SASI_Mm01_00047610 predicted 1027
8 SASI_Mm01_00047611 predicted 687
9 SASI_Mm01_00047612 predicted 1062
10 SASI_Mm01_00047613 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133734
VALIDATED
DCAF11 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 11
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133734.1-775s1c1
Sequence:CCGGCTGGTCTGACTACATTCATATCTCGAGATATGAATGTAGTCAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133734.1-1880s1c1
Sequence:CCGGCCAAGTGGTTTCCTTGTGCATCTCGAGATGCACAAGGAAACCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133734.1-1477s1c1
Sequence:CCGGGAGCGGCCACATTGTTAAGAACTCGAGTTCTTAACAATGTGGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133734.1-388s1c1
Sequence:CCGGGATCAAGACACAGGTGGGATTCTCGAGAATCCCACCTGTGTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-2150s21c1
Sequence:CCGGAGGTCTGAATGGACCCATTAGCTCGAGCTAATGGGTCCATTCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-1581s21c1
Sequence:CCGGGAGCGGCCACATTGTTAAGAACTCGAGTTCTTAACAATGTGGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-879s21c1
Sequence:CCGGCTGGTCTGACTACATTCATATCTCGAGATATGAATGTAGTCAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-423s21c1
Sequence:CCGGTCGCCTTGGAGATCGATATAACTCGAGTTATATCGATCTCCAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-492s21c1
Sequence:CCGGGATCAAGACACAGGTGGGATTCTCGAGAATCCCACCTGTGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133734
VALIDATED
DCAF11 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 11
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133734.1-775s1c1
Sequence:CCGGCTGGTCTGACTACATTCATATCTCGAGATATGAATGTAGTCAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133734.1-1880s1c1
Sequence:CCGGCCAAGTGGTTTCCTTGTGCATCTCGAGATGCACAAGGAAACCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133734.1-1477s1c1
Sequence:CCGGGAGCGGCCACATTGTTAAGAACTCGAGTTCTTAACAATGTGGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133734.1-388s1c1
Sequence:CCGGGATCAAGACACAGGTGGGATTCTCGAGAATCCCACCTGTGTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-2150s21c1
Sequence:CCGGAGGTCTGAATGGACCCATTAGCTCGAGCTAATGGGTCCATTCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-1581s21c1
Sequence:CCGGGAGCGGCCACATTGTTAAGAACTCGAGTTCTTAACAATGTGGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-879s21c1
Sequence:CCGGCTGGTCTGACTACATTCATATCTCGAGATATGAATGTAGTCAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-423s21c1
Sequence:CCGGTCGCCTTGGAGATCGATATAACTCGAGTTATATCGATCTCCAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-492s21c1
Sequence:CCGGGATCAAGACACAGGTGGGATTCTCGAGAATCCCACCTGTGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133734
VALIDATED
DCAF11 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 11
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133734.1-775s1c1
Sequence:CCGGCTGGTCTGACTACATTCATATCTCGAGATATGAATGTAGTCAGACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195775    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133734.1-1880s1c1
Sequence:CCGGCCAAGTGGTTTCCTTGTGCATCTCGAGATGCACAAGGAAACCACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133734.1-1477s1c1
Sequence:CCGGGAGCGGCCACATTGTTAAGAACTCGAGTTCTTAACAATGTGGCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133734.1-388s1c1
Sequence:CCGGGATCAAGACACAGGTGGGATTCTCGAGAATCCCACCTGTGTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336129    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-2150s21c1
Sequence:CCGGAGGTCTGAATGGACCCATTAGCTCGAGCTAATGGGTCCATTCAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-1581s21c1
Sequence:CCGGGAGCGGCCACATTGTTAAGAACTCGAGTTCTTAACAATGTGGCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-879s21c1
Sequence:CCGGCTGGTCTGACTACATTCATATCTCGAGATATGAATGTAGTCAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-423s21c1
Sequence:CCGGTCGCCTTGGAGATCGATATAACTCGAGTTATATCGATCTCCAAGGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133734.2-492s21c1
Sequence:CCGGGATCAAGACACAGGTGGGATTCTCGAGAATCCCACCTGTGTCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025230
DCAF11 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 11
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-2088s1c1
Sequence:CCGGGTGGTTGTGTACGACCTTCTACTCGAGTAGAAGGTCGTACACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025230.3-3975s1c1
Sequence:CCGGGCAGGAGAATCGCTTGAACTTCTCGAGAAGTTCAAGCGATTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-1629s1c1
Sequence:CCGGGCAGTGGCCTTTGCTGATATACTCGAGTATATCAGCAAAGGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1079s1c1
Sequence:CCGGGCACAGCTTTCCTCGAATGTTCTCGAGAACATTCGAGGAAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-2113s1c1
Sequence:CCGGGCCACATTGTGAAGAAGCTGACTCGAGTCAGCTTCTTCACAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1313s1c1
Sequence:CCGGCCGTAAATTCAAGAGCATCAACTCGAGTTGATGCTCTTGAATTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1630s1c1
Sequence:CCGGCAGTGGCCTTTGCTGATATAACTCGAGTTATATCAGCAAAGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-1811s1c1
Sequence:CCGGCAACTCTAAAGACCAGACCATCTCGAGATGGTCTGGTCTTTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1826s1c1
Sequence:CCGGGACCATCAAACTCTGGGATATCTCGAGATATCCCAGAGTTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025230.3-2764s1c1
Sequence:CCGGCCTTTCTTCCTGAGGTCTCTACTCGAGTAGAGACCTCAGGAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025230
DCAF11 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 11
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-2088s1c1
Sequence:CCGGGTGGTTGTGTACGACCTTCTACTCGAGTAGAAGGTCGTACACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025230.3-3975s1c1
Sequence:CCGGGCAGGAGAATCGCTTGAACTTCTCGAGAAGTTCAAGCGATTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-1629s1c1
Sequence:CCGGGCAGTGGCCTTTGCTGATATACTCGAGTATATCAGCAAAGGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1079s1c1
Sequence:CCGGGCACAGCTTTCCTCGAATGTTCTCGAGAACATTCGAGGAAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-2113s1c1
Sequence:CCGGGCCACATTGTGAAGAAGCTGACTCGAGTCAGCTTCTTCACAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1313s1c1
Sequence:CCGGCCGTAAATTCAAGAGCATCAACTCGAGTTGATGCTCTTGAATTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1630s1c1
Sequence:CCGGCAGTGGCCTTTGCTGATATAACTCGAGTTATATCAGCAAAGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-1811s1c1
Sequence:CCGGCAACTCTAAAGACCAGACCATCTCGAGATGGTCTGGTCTTTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1826s1c1
Sequence:CCGGGACCATCAAACTCTGGGATATCTCGAGATATCCCAGAGTTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025230.3-2764s1c1
Sequence:CCGGCCTTTCTTCCTGAGGTCTCTACTCGAGTAGAGACCTCAGGAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025230
DCAF11 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 11
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-2088s1c1
Sequence:CCGGGTGGTTGTGTACGACCTTCTACTCGAGTAGAAGGTCGTACACAACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138772    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025230.3-3975s1c1
Sequence:CCGGGCAGGAGAATCGCTTGAACTTCTCGAGAAGTTCAAGCGATTCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-1629s1c1
Sequence:CCGGGCAGTGGCCTTTGCTGATATACTCGAGTATATCAGCAAAGGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1079s1c1
Sequence:CCGGGCACAGCTTTCCTCGAATGTTCTCGAGAACATTCGAGGAAAGCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138006    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-2113s1c1
Sequence:CCGGGCCACATTGTGAAGAAGCTGACTCGAGTCAGCTTCTTCACAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1313s1c1
Sequence:CCGGCCGTAAATTCAAGAGCATCAACTCGAGTTGATGCTCTTGAATTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1630s1c1
Sequence:CCGGCAGTGGCCTTTGCTGATATAACTCGAGTTATATCAGCAAAGGCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137114    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025230.3-1811s1c1
Sequence:CCGGCAACTCTAAAGACCAGACCATCTCGAGATGGTCTGGTCTTTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025230.3-1826s1c1
Sequence:CCGGGACCATCAAACTCTGGGATATCTCGAGATATCCCAGAGTTTGATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137652    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025230.3-2764s1c1
Sequence:CCGGCCTTTCTTCCTGAGGTCTCTACTCGAGTAGAGACCTCAGGAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks