EMAIL THIS PAGE TO A FRIEND

DCAF12

DDB1 and CUL4 associated factor 12

119 Gene Product Result for
Synonyms: CT102 KIAA1892 TCC52 WDR40A
Gene ID:
Human(25853) Summary: This gene encodes a WD repeat-containing protein that interacts with the COP9 signalosome, a macromolecular complex that interacts with cullin-RING E3 ligases and regulates their activity by hydrolyzing cullin-Nedd8 conjugates. [provided by RefSeq, Jul 2009]
Mouse(68970) DDB1 and CUL4 associated factor 12
Rat(313296) DDB1 and CUL4 associated factor 12
Zebrafish(570671) DDB1 and CUL4 associated factor 12
dog(481584) DDB1 and CUL4 associated factor 12
Horse(100068462) DDB1 and CUL4 associated factor 12
cow(525161) DDB1 and CUL4 associated factor 12
domestic cat(101081421) DDB1 and CUL4 associated factor 12
chicken(427396) DDB1 and CUL4 associated factor 12
sheep(101102205) DDB1 and CUL4 associated factor 12
Domestic Rabbit(100344198) DDB1 and CUL4 associated factor 12
naked mole-rat(101697412) DDB1 and CUL4 associated factor 12
domestic guinea pig(100720707) DDB1 and CUL4 associated factor 12
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015397 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015397 Rosetta Predictions human pricing
NM_001107941 Rosetta Predictions rat pricing
NM_026893 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216314 predicted 1012
2 SASI_Hs01_00216315 predicted 579
3 SASI_Hs01_00216316 predicted 789
4 SASI_Hs01_00216317 predicted 380
5 SASI_Hs01_00216318 predicted 319
6 SASI_Hs02_00347757 predicted 1194
7 SASI_Hs01_00216319 predicted 632
8 SASI_Hs01_00216321 predicted 1215
9 SASI_Hs01_00216323 predicted 429
10 SASI_Hs02_00347758 predicted 1126
11 SASI_Hs01_00216320 predicted 1164
12 SASI_Hs01_00216322 predicted 576
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107941 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233795 predicted 1312
2 SASI_Rn02_00233796 predicted 1614
3 SASI_Rn02_00233797 predicted 1801
4 SASI_Rn02_00233798 predicted 1518
5 SASI_Rn02_00233799 predicted 1671
6 SASI_Rn02_00233800 predicted 1832
7 SASI_Rn02_00233801 predicted 1459
8 SASI_Rn02_00233802 predicted 1633
9 SASI_Rn02_00233803 predicted 1064
10 SASI_Rn02_00233804 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032393 predicted 1253
2 SASI_Mm01_00032394 predicted 1715
3 SASI_Mm01_00032395 predicted 638
4 SASI_Mm01_00032396 predicted 1086
5 SASI_Mm01_00032397 predicted 545
6 SASI_Mm01_00032398 predicted 284
7 SASI_Mm01_00032399 predicted 1122
8 SASI_Mm01_00032400 predicted 808
9 SASI_Mm01_00032401 predicted 709
10 SASI_Mm01_00032402 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026893
VALIDATED
DCAF12 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 12
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.3-411s21c1
Sequence:CCGGGCAGTTTGGCTGGGATCATTCCTCGAGGAATGATCCCAGCCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.2-755s21c1
Sequence:CCGGCCCTAACAGTCTTGCCATCTACTCGAGTAGATGGCAAGACTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026893.2-1725s21c1
Sequence:CCGGTGTCTATGCAAACAGAGTTTGCTCGAGCAAACTCTGTTTGCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026893.2-578s21c1
Sequence:CCGGAGTGGTGTGTGGCACGAAATGCTCGAGCATTTCGTGCCACACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.2-1136s21c1
Sequence:CCGGCCTTTCCACCAAATTGCCATACTCGAGTATGGCAATTTGGTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026893.2-843s21c3
Sequence:CCGGGCGTGGATCAACGATACTATGCTCGAGCATAGTATCGTTGATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026893.3-2194s21c1
Sequence:CCGGGGTACTGCATCACTGATACTACTCGAGTAGTATCAGTGATGCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026893.2-2439s1c1
Sequence:CCGGGCCACATCACAGCCTAGATAACTCGAGTTATCTAGGCTGTGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-755s1c1
Sequence:CCGGCCCTAACAGTCTTGCCATCTACTCGAGTAGATGGCAAGACTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-1677s1c1
Sequence:CCGGCCACCCTCAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-1136s1c1
Sequence:CCGGCCTTTCCACCAAATTGCCATACTCGAGTATGGCAATTTGGTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026893
VALIDATED
DCAF12 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 12
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.3-411s21c1
Sequence:CCGGGCAGTTTGGCTGGGATCATTCCTCGAGGAATGATCCCAGCCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.2-755s21c1
Sequence:CCGGCCCTAACAGTCTTGCCATCTACTCGAGTAGATGGCAAGACTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026893.2-1725s21c1
Sequence:CCGGTGTCTATGCAAACAGAGTTTGCTCGAGCAAACTCTGTTTGCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026893.2-578s21c1
Sequence:CCGGAGTGGTGTGTGGCACGAAATGCTCGAGCATTTCGTGCCACACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.2-1136s21c1
Sequence:CCGGCCTTTCCACCAAATTGCCATACTCGAGTATGGCAATTTGGTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026893.2-843s21c3
Sequence:CCGGGCGTGGATCAACGATACTATGCTCGAGCATAGTATCGTTGATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026893.3-2194s21c1
Sequence:CCGGGGTACTGCATCACTGATACTACTCGAGTAGTATCAGTGATGCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026893.2-2439s1c1
Sequence:CCGGGCCACATCACAGCCTAGATAACTCGAGTTATCTAGGCTGTGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-755s1c1
Sequence:CCGGCCCTAACAGTCTTGCCATCTACTCGAGTAGATGGCAAGACTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-1677s1c1
Sequence:CCGGCCACCCTCAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-1136s1c1
Sequence:CCGGCCTTTCCACCAAATTGCCATACTCGAGTATGGCAATTTGGTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026893
VALIDATED
DCAF12 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 12
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.3-411s21c1
Sequence:CCGGGCAGTTTGGCTGGGATCATTCCTCGAGGAATGATCCCAGCCAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.2-755s21c1
Sequence:CCGGCCCTAACAGTCTTGCCATCTACTCGAGTAGATGGCAAGACTGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276858    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026893.2-1725s21c1
Sequence:CCGGTGTCTATGCAAACAGAGTTTGCTCGAGCAAACTCTGTTTGCATAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026893.2-578s21c1
Sequence:CCGGAGTGGTGTGTGGCACGAAATGCTCGAGCATTTCGTGCCACACACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026893.2-1136s21c1
Sequence:CCGGCCTTTCCACCAAATTGCCATACTCGAGTATGGCAATTTGGTGGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026893.2-843s21c3
Sequence:CCGGGCGTGGATCAACGATACTATGCTCGAGCATAGTATCGTTGATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026893.3-2194s21c1
Sequence:CCGGGGTACTGCATCACTGATACTACTCGAGTAGTATCAGTGATGCAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196116    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026893.2-2439s1c1
Sequence:CCGGGCCACATCACAGCCTAGATAACTCGAGTTATCTAGGCTGTGATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-755s1c1
Sequence:CCGGCCCTAACAGTCTTGCCATCTACTCGAGTAGATGGCAAGACTGTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183878    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-1677s1c1
Sequence:CCGGCCACCCTCAGTTTCCTTGTTTCTCGAGAAACAAGGAAACTGAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026893.2-1136s1c1
Sequence:CCGGCCTTTCCACCAAATTGCCATACTCGAGTATGGCAATTTGGTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015397
VALIDATED
DCAF12 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 12
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000168231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-1514s1c1
Sequence:CCGGCATGATGAAACCTGGAGGAATCTCGAGATTCCTCCAGGTTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-428s1c1
Sequence:CCGGCCTGTGAAGAGATCCTTAGTACTCGAGTACTAAGGATCTCTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-1503s1c1
Sequence:CCGGGCTGGCTGAATCATGATGAAACTCGAGTTTCATCATGATTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-2949s1c1
Sequence:CCGGCCTCCCTTGAACTGTCTGTTTCTCGAGAAACAGACAGTTCAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015397
VALIDATED
DCAF12 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 12
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000168231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-1514s1c1
Sequence:CCGGCATGATGAAACCTGGAGGAATCTCGAGATTCCTCCAGGTTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-428s1c1
Sequence:CCGGCCTGTGAAGAGATCCTTAGTACTCGAGTACTAAGGATCTCTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-1503s1c1
Sequence:CCGGGCTGGCTGAATCATGATGAAACTCGAGTTTCATCATGATTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-2949s1c1
Sequence:CCGGCCTCCCTTGAACTGTCTGTTTCTCGAGAAACAGACAGTTCAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015397
VALIDATED
DCAF12 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 12
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000168231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-1514s1c1
Sequence:CCGGCATGATGAAACCTGGAGGAATCTCGAGATTCCTCCAGGTTTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-428s1c1
Sequence:CCGGCCTGTGAAGAGATCCTTAGTACTCGAGTACTAAGGATCTCTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-1503s1c1
Sequence:CCGGGCTGGCTGAATCATGATGAAACTCGAGTTTCATCATGATTCAGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173036    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015397.1-2949s1c1
Sequence:CCGGCCTCCCTTGAACTGTCTGTTTCTCGAGAAACAGACAGTTCAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks