EMAIL THIS PAGE TO A FRIEND

DCAF12L1

DDB1 and CUL4 associated factor 12-like 1

129 Gene Product Result for
Synonyms: KIAA1892L WDR40B
UniProtKB ID: Q5VU92, Q8IYK3
Gene ID:
Human(139170) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. [provided by RefSeq, Jul 2008]
Mouse(245404) DDB1 and CUL4 associated factor 12-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178470 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178739 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178739 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178739 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178470 Rosetta Predictions human pricing
NM_178739 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050095 predicted 1180
2 SASI_Hs01_00050096 predicted 1663
3 SASI_Hs01_00050097 predicted 1180
4 SASI_Hs01_00050098 predicted 1304
5 SASI_Hs01_00050099 predicted 1147
6 SASI_Hs01_00050101 predicted 1792
7 SASI_Hs01_00050102 predicted 1477
8 SASI_Hs01_00050103 predicted 1777
9 SASI_Hs02_00369721 predicted 1825
10 SASI_Hs02_00369722 predicted 1811
11 SASI_Hs01_00050094 predicted 1476
12 SASI_Hs01_00050100 predicted 1920
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178739 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067324 predicted 1751
2 SASI_Mm01_00067325 predicted 1418
3 SASI_Mm01_00067326 predicted 1845
4 SASI_Mm01_00067327 predicted 1570
5 SASI_Mm01_00067328 predicted 1591
6 SASI_Mm01_00067329 predicted 686
7 SASI_Mm01_00067330 predicted 1114
8 SASI_Mm01_00067331 predicted 1255
9 SASI_Mm01_00067332 predicted 1858
10 SASI_Mm01_00067333 predicted 1029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178470
DCAF12L1 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 12-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1379s1c1
Sequence:CCGGCCCAGAAATTCCTGGAGGAAACTCGAGTTTCCTCCAGGAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1470s1c1
Sequence:CCGGCTGGCTCAACCACAATGATTTCTCGAGAAATCATTGTGGTTGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1479s1c1
Sequence:CCGGCCACAATGATTTCTGGGTGAACTCGAGTTCACCCAGAAATCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1561s1c1
Sequence:CCGGGAGATGAAGCTCTTTGTGGCTCTCGAGAGCCACAAAGAGCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-584s1c1
Sequence:CCGGGCACCAAGTGTAACACGCTTTCTCGAGAAAGCGTGTTACACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178470.4-1160s21c1
Sequence:CCGGGCCCTACTTCCGGGATAATGTCTCGAGACATTATCCCGGAAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178470.4-393s21c1
Sequence:CCGGTATCGCTCGATGGCGCACTATCTCGAGATAGTGCGCCATCGAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178470.4-1829s21c1
Sequence:CCGGCTCTCTTTGAGTGATTCATACCTCGAGGTATGAATCACTCAAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178470
DCAF12L1 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 12-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1379s1c1
Sequence:CCGGCCCAGAAATTCCTGGAGGAAACTCGAGTTTCCTCCAGGAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1470s1c1
Sequence:CCGGCTGGCTCAACCACAATGATTTCTCGAGAAATCATTGTGGTTGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1479s1c1
Sequence:CCGGCCACAATGATTTCTGGGTGAACTCGAGTTCACCCAGAAATCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1561s1c1
Sequence:CCGGGAGATGAAGCTCTTTGTGGCTCTCGAGAGCCACAAAGAGCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-584s1c1
Sequence:CCGGGCACCAAGTGTAACACGCTTTCTCGAGAAAGCGTGTTACACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178470.4-1160s21c1
Sequence:CCGGGCCCTACTTCCGGGATAATGTCTCGAGACATTATCCCGGAAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178470.4-393s21c1
Sequence:CCGGTATCGCTCGATGGCGCACTATCTCGAGATAGTGCGCCATCGAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178470.4-1829s21c1
Sequence:CCGGCTCTCTTTGAGTGATTCATACCTCGAGGTATGAATCACTCAAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178470
DCAF12L1 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 12-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1379s1c1
Sequence:CCGGCCCAGAAATTCCTGGAGGAAACTCGAGTTTCCTCCAGGAATTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1470s1c1
Sequence:CCGGCTGGCTCAACCACAATGATTTCTCGAGAAATCATTGTGGTTGAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1479s1c1
Sequence:CCGGCCACAATGATTTCTGGGTGAACTCGAGTTCACCCAGAAATCATTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-1561s1c1
Sequence:CCGGGAGATGAAGCTCTTTGTGGCTCTCGAGAGCCACAAAGAGCTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178470.2-584s1c1
Sequence:CCGGGCACCAAGTGTAACACGCTTTCTCGAGAAAGCGTGTTACACTTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178470.4-1160s21c1
Sequence:CCGGGCCCTACTTCCGGGATAATGTCTCGAGACATTATCCCGGAAGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178470.4-393s21c1
Sequence:CCGGTATCGCTCGATGGCGCACTATCTCGAGATAGTGCGCCATCGAGCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434699    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178470.4-1829s21c1
Sequence:CCGGCTCTCTTTGAGTGATTCATACCTCGAGGTATGAATCACTCAAAGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178739
DCAF12L1 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 12-like 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1075s1c1
Sequence:CCGGCTCACATCAGTCCTACAGATACTCGAGTATCTGTAGGACTGATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1146s1c1
Sequence:CCGGGCACTTGCCTTCAGCAACAAACTCGAGTTTGTTGCTGAAGGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178739.3-3209s1c1
Sequence:CCGGGCAGGTCTATTTCATAGAATTCTCGAGAATTCTATGAAATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1074s1c1
Sequence:CCGGGCTCACATCAGTCCTACAGATCTCGAGATCTGTAGGACTGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1253s1c1
Sequence:CCGGGCTGCCCTATTGCCGTGAGAACTCGAGTTCTCACGGCAATAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000453570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178739.5-1587s21c1
Sequence:CCGGATGATCTTCTAGAGAATTATGCTCGAGCATAATTCTCTAGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178739.5-1412s21c1
Sequence:CCGGCTGAGTGTCCACCAGCATATTCTCGAGAATATGCTGGTGGACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178739
DCAF12L1 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 12-like 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1075s1c1
Sequence:CCGGCTCACATCAGTCCTACAGATACTCGAGTATCTGTAGGACTGATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1146s1c1
Sequence:CCGGGCACTTGCCTTCAGCAACAAACTCGAGTTTGTTGCTGAAGGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178739.3-3209s1c1
Sequence:CCGGGCAGGTCTATTTCATAGAATTCTCGAGAATTCTATGAAATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1074s1c1
Sequence:CCGGGCTCACATCAGTCCTACAGATCTCGAGATCTGTAGGACTGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1253s1c1
Sequence:CCGGGCTGCCCTATTGCCGTGAGAACTCGAGTTCTCACGGCAATAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000453570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178739.5-1587s21c1
Sequence:CCGGATGATCTTCTAGAGAATTATGCTCGAGCATAATTCTCTAGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178739.5-1412s21c1
Sequence:CCGGCTGAGTGTCCACCAGCATATTCTCGAGAATATGCTGGTGGACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178739
DCAF12L1 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 12-like 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1075s1c1
Sequence:CCGGCTCACATCAGTCCTACAGATACTCGAGTATCTGTAGGACTGATGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1146s1c1
Sequence:CCGGGCACTTGCCTTCAGCAACAAACTCGAGTTTGTTGCTGAAGGCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120222    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178739.3-3209s1c1
Sequence:CCGGGCAGGTCTATTTCATAGAATTCTCGAGAATTCTATGAAATAGACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1074s1c1
Sequence:CCGGGCTCACATCAGTCCTACAGATCTCGAGATCTGTAGGACTGATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178739.3-1253s1c1
Sequence:CCGGGCTGCCCTATTGCCGTGAGAACTCGAGTTCTCACGGCAATAGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000453570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178739.5-1587s21c1
Sequence:CCGGATGATCTTCTAGAGAATTATGCTCGAGCATAATTCTCTAGAAGATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178739.5-1412s21c1
Sequence:CCGGCTGAGTGTCCACCAGCATATTCTCGAGAATATGCTGGTGGACACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks