EMAIL THIS PAGE TO A FRIEND

DCAF13

DDB1 and CUL4 associated factor 13

Synonyms: GM83 WDSOF1
UniProtKB ID: Q9NV06, Q3MII9, Q8NCH8, Q8TC51, Q96JY7, Q9NZX3
Gene ID:
Mouse(223499) DDB1 and CUL4 associated factor 13
Rat(362902) DDB1 and CUL4 associated factor 13
naked mole-rat(101724782) DDB1 and CUL4 associated factor 13
domestic guinea pig(100718458) DDB1 and CUL4 associated factor 13
sheep(101102821) DDB1 and CUL4 associated factor 13
Zebrafish(393097) ddb1 and cul4 associated factor 13
chicken(420263) DDB1 and CUL4 associated factor 13
cow(100138632) DDB1 and CUL4 associated factor 13
Horse(100062586) DDB1 and CUL4 associated factor 13
domestic cat(101084515) DDB1 and CUL4 associated factor 13
dog(475065) DDB1 and CUL4 associated factor 13
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198606 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198606 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198606 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015420 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015420 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015420 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015420 Rosetta Predictions human pricing
XM_001061920 Rosetta Predictions rat pricing
XM_001081959 Rosetta Predictions rat pricing
XM_343231 Rosetta Predictions rat pricing
NM_198606 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015420 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171049 predicted 1646
2 SASI_Hs01_00171050 predicted 1200
3 SASI_Hs01_00171051 predicted 989
4 SASI_Hs01_00171052 predicted 1346
5 SASI_Hs01_00171053 predicted 1869
6 SASI_Hs01_00171054 predicted 1928
7 SASI_Hs01_00171055 predicted 1010
8 SASI_Hs01_00171056 predicted 1373
9 SASI_Hs01_00171057 predicted 1379
10 SASI_Hs01_00171058 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301813 predicted 659
2 SASI_Rn02_00301814 predicted 382
3 SASI_Rn02_00301815 predicted 523
4 SASI_Rn02_00301816 predicted 1084
5 SASI_Rn02_00301817 predicted 836
6 SASI_Rn02_00301818 predicted 891
7 SASI_Rn02_00301819 predicted 683
8 SASI_Rn02_00301820 predicted 550
9 SASI_Rn02_00301821 predicted 672
10 SASI_Rn02_00301822 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081959 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374241 predicted 1170
2 SASI_Rn02_00374242 predicted 1178
3 SASI_Rn02_00374243 predicted 1186
4 SASI_Rn02_00374244 predicted 1214
5 SASI_Rn02_00374245 predicted 1275
6 SASI_Rn02_00374246 predicted 1178
7 SASI_Rn02_00374247 predicted 1232
8 SASI_Rn02_00374248 predicted 1229
9 SASI_Rn02_00374249 predicted 1181
10 SASI_Rn02_00374250 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00137571 predicted 1042
2 SASI_Rn01_00137572 predicted 837
3 SASI_Rn01_00137573 predicted 888
4 SASI_Rn01_00137574 predicted 1113
5 SASI_Rn01_00137575 predicted 1144
6 SASI_Rn01_00137576 predicted 1061
7 SASI_Rn01_00137577 predicted 1044
8 SASI_Rn01_00137578 predicted 809
9 SASI_Rn01_00137579 predicted 765
10 SASI_Rn01_00137580 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198606 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147562 predicted 360
2 SASI_Mm01_00147563 predicted 701
3 SASI_Mm01_00147564 predicted 924
4 SASI_Mm01_00147565 predicted 582
5 SASI_Mm01_00147566 predicted 1155
6 SASI_Mm01_00147567 predicted 738
7 SASI_Mm01_00147568 predicted 623
8 SASI_Mm01_00147569 predicted 874
9 SASI_Mm01_00147571 predicted 562
10 SASI_Mm02_00351015 predicted 243
11 SASI_Mm01_00147570 predicted 281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198606
VALIDATED
DCAF13 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 13
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198606.1-1311s1c1
Sequence:CCGGCGTCGTAAACATAGCAAGCCTCTCGAGAGGCTTGCTATGTTTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.1-79s1c1
Sequence:CCGGCTGACAACTATGTCCGCGAAACTCGAGTTTCGCGGACATAGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-665s1c1
Sequence:CCGGCCCTGTTGAGACATTTCTCTTCTCGAGAAGAGAAATGTCTCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-948s1c1
Sequence:CCGGGCCAGCTTTGATAAGTCTATTCTCGAGAATAGACTTATCAAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-1241s1c1
Sequence:CCGGGAAATCTATCTACAGCCAGATCTCGAGATCTGGCTGTAGATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.2-749s1c1
Sequence:CCGGGTTGTGCTTCTGATAGGAATACTCGAGTATTCCTATCAGAAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.2-1222s1c1
Sequence:CCGGGATTATAACCAGAAGTTAAAGCTCGAGCTTTAACTTCTGGTTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-723s21c1
Sequence:CCGGCCCTGTTGAGACATTTCTCTTCTCGAGAAGAGAAATGTCTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-629s21c1
Sequence:CCGGGTGGACAGCAAGTAGACATTTCTCGAGAAATGTCTACTTGCTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-1299s21c1
Sequence:CCGGGAAATCTATCTACAGCCAGATCTCGAGATCTGGCTGTAGATAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-1006s21c1
Sequence:CCGGGCCAGCTTTGATAAGTCTATTCTCGAGAATAGACTTATCAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198606
VALIDATED
DCAF13 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 13
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198606.1-1311s1c1
Sequence:CCGGCGTCGTAAACATAGCAAGCCTCTCGAGAGGCTTGCTATGTTTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.1-79s1c1
Sequence:CCGGCTGACAACTATGTCCGCGAAACTCGAGTTTCGCGGACATAGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-665s1c1
Sequence:CCGGCCCTGTTGAGACATTTCTCTTCTCGAGAAGAGAAATGTCTCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-948s1c1
Sequence:CCGGGCCAGCTTTGATAAGTCTATTCTCGAGAATAGACTTATCAAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-1241s1c1
Sequence:CCGGGAAATCTATCTACAGCCAGATCTCGAGATCTGGCTGTAGATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.2-749s1c1
Sequence:CCGGGTTGTGCTTCTGATAGGAATACTCGAGTATTCCTATCAGAAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.2-1222s1c1
Sequence:CCGGGATTATAACCAGAAGTTAAAGCTCGAGCTTTAACTTCTGGTTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-723s21c1
Sequence:CCGGCCCTGTTGAGACATTTCTCTTCTCGAGAAGAGAAATGTCTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-629s21c1
Sequence:CCGGGTGGACAGCAAGTAGACATTTCTCGAGAAATGTCTACTTGCTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-1299s21c1
Sequence:CCGGGAAATCTATCTACAGCCAGATCTCGAGATCTGGCTGTAGATAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-1006s21c1
Sequence:CCGGGCCAGCTTTGATAAGTCTATTCTCGAGAATAGACTTATCAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198606
VALIDATED
DCAF13 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 13
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198606.1-1311s1c1
Sequence:CCGGCGTCGTAAACATAGCAAGCCTCTCGAGAGGCTTGCTATGTTTACGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.1-79s1c1
Sequence:CCGGCTGACAACTATGTCCGCGAAACTCGAGTTTCGCGGACATAGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-665s1c1
Sequence:CCGGCCCTGTTGAGACATTTCTCTTCTCGAGAAGAGAAATGTCTCAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-948s1c1
Sequence:CCGGGCCAGCTTTGATAAGTCTATTCTCGAGAATAGACTTATCAAAGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198606.1-1241s1c1
Sequence:CCGGGAAATCTATCTACAGCCAGATCTCGAGATCTGGCTGTAGATAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.2-749s1c1
Sequence:CCGGGTTGTGCTTCTGATAGGAATACTCGAGTATTCCTATCAGAAGCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198606.2-1222s1c1
Sequence:CCGGGATTATAACCAGAAGTTAAAGCTCGAGCTTTAACTTCTGGTTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-723s21c1
Sequence:CCGGCCCTGTTGAGACATTTCTCTTCTCGAGAAGAGAAATGTCTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-629s21c1
Sequence:CCGGGTGGACAGCAAGTAGACATTTCTCGAGAAATGTCTACTTGCTGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-1299s21c1
Sequence:CCGGGAAATCTATCTACAGCCAGATCTCGAGATCTGGCTGTAGATAGATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198606.2-1006s21c1
Sequence:CCGGGCCAGCTTTGATAAGTCTATTCTCGAGAATAGACTTATCAAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015420
VALIDATED
DCAF13 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 13
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015420.4-337s1c1
Sequence:CCGGGACCAACGAGAGGACTCTTATCTCGAGATAAGAGTCCTCTCGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015420.4-873s1c1
Sequence:CCGGGCTACCAAACTGGAACGAGTACTCGAGTACTCGTTCCAGTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1783s1c1
Sequence:CCGGGCCTGTGGAAAGCTAATGCTTCTCGAGAAGCATTAGCTTTCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1974s1c1
Sequence:CCGGCGTCGACGAAAGGAAGTGAATCTCGAGATTCACTTCCTTTCGTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1653s1c1
Sequence:CCGGCGAATCTTTCCTGTAGACAAACTCGAGTTTGTCTACAGGAAAGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015420.4-807s1c1
Sequence:CCGGCCAAGAAACTATGATCCTGCTCTCGAGAGCAGGATCATAGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015420.4-1943s1c1
Sequence:CCGGGATTCAGGAACAGCGCATCATCTCGAGATGATGCGCTGTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1015s21c1
Sequence:CCGGGAATCTAACTCAGCGGAATTGCTCGAGCAATTCCGCTGAGTTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1174s21c1
Sequence:CCGGAGAGCCATTACATACAATATTCTCGAGAATATTGTATGTAATGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1619s21c1
Sequence:CCGGGAGTTTGTGTCTGCTAGTTTCCTCGAGGAAACTAGCAGACACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-925s21c1
Sequence:CCGGTCACCGTGATGGAGTCAATTGCTCGAGCAATTGACTCCATCACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015420
VALIDATED
DCAF13 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 13
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015420.4-337s1c1
Sequence:CCGGGACCAACGAGAGGACTCTTATCTCGAGATAAGAGTCCTCTCGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015420.4-873s1c1
Sequence:CCGGGCTACCAAACTGGAACGAGTACTCGAGTACTCGTTCCAGTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1783s1c1
Sequence:CCGGGCCTGTGGAAAGCTAATGCTTCTCGAGAAGCATTAGCTTTCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1974s1c1
Sequence:CCGGCGTCGACGAAAGGAAGTGAATCTCGAGATTCACTTCCTTTCGTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1653s1c1
Sequence:CCGGCGAATCTTTCCTGTAGACAAACTCGAGTTTGTCTACAGGAAAGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015420.4-807s1c1
Sequence:CCGGCCAAGAAACTATGATCCTGCTCTCGAGAGCAGGATCATAGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015420.4-1943s1c1
Sequence:CCGGGATTCAGGAACAGCGCATCATCTCGAGATGATGCGCTGTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1015s21c1
Sequence:CCGGGAATCTAACTCAGCGGAATTGCTCGAGCAATTCCGCTGAGTTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1174s21c1
Sequence:CCGGAGAGCCATTACATACAATATTCTCGAGAATATTGTATGTAATGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1619s21c1
Sequence:CCGGGAGTTTGTGTCTGCTAGTTTCCTCGAGGAAACTAGCAGACACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-925s21c1
Sequence:CCGGTCACCGTGATGGAGTCAATTGCTCGAGCAATTGACTCCATCACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015420
VALIDATED
DCAF13 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 13
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015420.4-337s1c1
Sequence:CCGGGACCAACGAGAGGACTCTTATCTCGAGATAAGAGTCCTCTCGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015420.4-873s1c1
Sequence:CCGGGCTACCAAACTGGAACGAGTACTCGAGTACTCGTTCCAGTTTGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1783s1c1
Sequence:CCGGGCCTGTGGAAAGCTAATGCTTCTCGAGAAGCATTAGCTTTCCACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1974s1c1
Sequence:CCGGCGTCGACGAAAGGAAGTGAATCTCGAGATTCACTTCCTTTCGTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015420.4-1653s1c1
Sequence:CCGGCGAATCTTTCCTGTAGACAAACTCGAGTTTGTCTACAGGAAAGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015420.4-807s1c1
Sequence:CCGGCCAAGAAACTATGATCCTGCTCTCGAGAGCAGGATCATAGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138123    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015420.4-1943s1c1
Sequence:CCGGGATTCAGGAACAGCGCATCATCTCGAGATGATGCGCTGTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1015s21c1
Sequence:CCGGGAATCTAACTCAGCGGAATTGCTCGAGCAATTCCGCTGAGTTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1174s21c1
Sequence:CCGGAGAGCCATTACATACAATATTCTCGAGAATATTGTATGTAATGGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-1619s21c1
Sequence:CCGGGAGTTTGTGTCTGCTAGTTTCCTCGAGGAAACTAGCAGACACAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015420.6-925s21c1
Sequence:CCGGTCACCGTGATGGAGTCAATTGCTCGAGCAATTGACTCCATCACGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks