EMAIL THIS PAGE TO A FRIEND

DCAF15

DDB1 and CUL4 associated factor 15

126 Gene Product Result for
Synonyms: C19orf72
UniProtKB ID: Q66K64, B3KS86, Q96DW0, Q9BU31
Gene ID:
Mouse(212123) DDB1 and CUL4 associated factor 15
Rat(304653) DDB1 and CUL4 associated factor 15
Zebrafish(555243) DDB1 and CUL4 associated factor 15
dog(484909) DDB1 and CUL4 associated factor 15
cow(539970) DDB1 and CUL4 associated factor 15
domestic cat(101096039) DDB1 and CUL4 associated factor 15
domestic guinea pig(100723912) DDB1 and CUL4 associated factor 15
naked mole-rat(101703273) DDB1 and CUL4 associated factor 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138353 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU088401 MISSION® esiRNA esiRNA targeting mouse BC057552 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138353 Rosetta Predictions human pricing
XM_930418 Rosetta Predictions human pricing
XM_934753 Rosetta Predictions human pricing
XM_934754 Rosetta Predictions human pricing
XM_934755 Rosetta Predictions human pricing
XM_934756 Rosetta Predictions human pricing
XM_934757 Rosetta Predictions human pricing
XM_934758 Rosetta Predictions human pricing
XM_934759 Rosetta Predictions human pricing
NM_001107162 Rosetta Predictions rat pricing
NM_172502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099992 predicted 340
2 SASI_Hs01_00099993 predicted 1730
3 SASI_Hs01_00099994 predicted 1900
4 SASI_Hs01_00099995 predicted 1420
5 SASI_Hs01_00099996 predicted 1341
6 SASI_Hs01_00099997 predicted 309
7 SASI_Hs01_00099998 predicted 455
8 SASI_Hs01_00099999 predicted 1341
9 SASI_Hs01_00100001 predicted 1728
10 SASI_Hs02_00363444 predicted 298
11 SASI_Hs01_00100000 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254280 predicted 362
2 SASI_Hs01_00254281 predicted 1747
3 SASI_Hs01_00254282 predicted 1927
4 SASI_Hs01_00254283 predicted 1437
5 SASI_Hs01_00254284 predicted 1357
6 SASI_Hs01_00254285 predicted 327
7 SASI_Hs01_00254286 predicted 482
8 SASI_Hs01_00254287 predicted 1361
9 SASI_Hs01_00254288 predicted 1599
10 SASI_Hs01_00254289 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934753 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287702 predicted 606
2 SASI_Hs01_00287703 predicted 2003
3 SASI_Hs01_00287704 predicted 2172
4 SASI_Hs01_00287705 predicted 1807
5 SASI_Hs01_00287706 predicted 1684
6 SASI_Hs01_00287707 predicted 1608
7 SASI_Hs01_00287708 predicted 726
8 SASI_Hs01_00287709 predicted 1605
9 SASI_Hs01_00287710 predicted 1846
10 SASI_Hs01_00287711 predicted 1999
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934754 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254326 predicted 1160
2 SASI_Hs01_00254327 predicted 465
3 SASI_Hs01_00254328 predicted 356
4 SASI_Hs01_00254329 predicted 1134
5 SASI_Hs01_00254330 predicted 335
6 SASI_Hs01_00254331 predicted 475
7 SASI_Hs01_00254332 predicted 318
8 SASI_Hs01_00254333 predicted 951
9 SASI_Hs01_00254334 predicted 347
10 SASI_Hs01_00254335 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260841 predicted 474
2 SASI_Hs01_00260842 predicted 364
3 SASI_Hs01_00260843 predicted 331
4 SASI_Hs01_00260844 predicted 1179
5 SASI_Hs01_00260845 predicted 552
6 SASI_Hs01_00260846 predicted 477
7 SASI_Hs01_00260847 predicted 317
8 SASI_Hs01_00260848 predicted 548
9 SASI_Hs01_00260849 predicted 1207
10 SASI_Hs01_00260850 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00280940 predicted 465
2 SASI_Hs01_00280941 predicted 362
3 SASI_Hs01_00280942 predicted 1357
4 SASI_Hs01_00280943 predicted 329
5 SASI_Hs01_00280944 predicted 482
6 SASI_Hs01_00280945 predicted 317
7 SASI_Hs01_00280946 predicted 1208
8 SASI_Hs01_00280947 predicted 344
9 SASI_Hs01_00280948 predicted 555
10 SASI_Hs01_00280949 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00271949 predicted 471
2 SASI_Hs01_00271950 predicted 365
3 SASI_Hs01_00271951 predicted 333
4 SASI_Hs01_00271952 predicted 1179
5 SASI_Hs01_00271953 predicted 547
6 SASI_Hs01_00271954 predicted 475
7 SASI_Hs01_00271955 predicted 326
8 SASI_Hs01_00271956 predicted 551
9 SASI_Hs01_00271957 predicted 1202
10 SASI_Hs01_00271958 predicted 1240
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934758 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295541 predicted 692
2 SASI_Hs01_00295542 predicted 697
3 SASI_Hs01_00295543 predicted 680
4 SASI_Hs01_00295544 predicted 704
5 SASI_Hs01_00295545 predicted 700
6 SASI_Hs01_00295546 predicted 682
7 SASI_Hs01_00295547 predicted 697
8 SASI_Hs01_00295548 predicted 1007
9 SASI_Hs01_00295549 predicted 516
10 SASI_Hs01_00295550 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00254207 predicted 521
2 SASI_Hs01_00254208 predicted 541
3 SASI_Hs01_00254209 predicted 592
4 SASI_Hs01_00254210 predicted 662
5 SASI_Hs01_00254211 predicted 674
6 SASI_Hs01_00254212 predicted 533
7 SASI_Hs01_00254213 predicted 513
8 SASI_Hs01_00254214 predicted 547
9 SASI_Hs01_00254215 predicted 535
10 SASI_Hs01_00254216 predicted 678
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226115 predicted 479
2 SASI_Rn02_00226116 predicted 363
3 SASI_Rn02_00226117 predicted 1263
4 SASI_Rn02_00226118 predicted 1440
5 SASI_Rn02_00226119 predicted 1254
6 SASI_Rn02_00226120 predicted 818
7 SASI_Rn02_00226121 predicted 1557
8 SASI_Rn02_00226122 predicted 423
9 SASI_Rn02_00226123 predicted 1378
10 SASI_Rn02_00226124 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081006 predicted 453
2 SASI_Mm02_00344087 predicted 973
3 SASI_Mm01_00081008 predicted 1420
4 SASI_Mm01_00081009 predicted 1544
5 SASI_Mm01_00081010 predicted 995
6 SASI_Mm02_00344088 predicted 1181
7 SASI_Mm01_00081011 predicted 337
8 SASI_Mm01_00081012 predicted 405
9 SASI_Mm01_00081013 predicted 664
10 SASI_Mm01_00081014 predicted 1607
11 SASI_Mm01_00081005 predicted 1764
12 SASI_Mm01_00081007 predicted 360
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138353
DCAF15 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 15
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1463s21c1
Sequence:CCGGACCAGGTCCTCATCAACATTGCTCGAGCAATGTTGATGAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1409s21c1
Sequence:CCGGTCTGTTCTTTCAGCGACTATGCTCGAGCATAGTCGCTGAAAGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1169s21c1
Sequence:CCGGACTACACCAAGCTGTACTATGCTCGAGCATAGTACAGCTTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138353.2-1825s21c1
Sequence:CCGGGGACACTGACTCCAACTACCTCTCGAGAGGTAGTTGGAGTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1343s21c1
Sequence:CCGGTCACACTAGACTTCGAATATGCTCGAGCATATTCGAAGTCTAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-192s1c1
Sequence:CCGGCGTGTCCCTCAAGAACATTGTCTCGAGACAATGTTCTTGAGGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-1167s1c1
Sequence:CCGGCAACTACACCAAGCTGTACTACTCGAGTAGTACAGCTTGGTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-492s1c1
Sequence:CCGGCAACGGGATGCTCATGAACATCTCGAGATGTTCATGAGCATCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138353
DCAF15 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 15
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1463s21c1
Sequence:CCGGACCAGGTCCTCATCAACATTGCTCGAGCAATGTTGATGAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1409s21c1
Sequence:CCGGTCTGTTCTTTCAGCGACTATGCTCGAGCATAGTCGCTGAAAGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1169s21c1
Sequence:CCGGACTACACCAAGCTGTACTATGCTCGAGCATAGTACAGCTTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138353.2-1825s21c1
Sequence:CCGGGGACACTGACTCCAACTACCTCTCGAGAGGTAGTTGGAGTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1343s21c1
Sequence:CCGGTCACACTAGACTTCGAATATGCTCGAGCATATTCGAAGTCTAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-192s1c1
Sequence:CCGGCGTGTCCCTCAAGAACATTGTCTCGAGACAATGTTCTTGAGGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-1167s1c1
Sequence:CCGGCAACTACACCAAGCTGTACTACTCGAGTAGTACAGCTTGGTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-492s1c1
Sequence:CCGGCAACGGGATGCTCATGAACATCTCGAGATGTTCATGAGCATCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138353
DCAF15 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 15
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1463s21c1
Sequence:CCGGACCAGGTCCTCATCAACATTGCTCGAGCAATGTTGATGAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1409s21c1
Sequence:CCGGTCTGTTCTTTCAGCGACTATGCTCGAGCATAGTCGCTGAAAGAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1169s21c1
Sequence:CCGGACTACACCAAGCTGTACTATGCTCGAGCATAGTACAGCTTGGTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138353.2-1825s21c1
Sequence:CCGGGGACACTGACTCCAACTACCTCTCGAGAGGTAGTTGGAGTCAGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138353.2-1343s21c1
Sequence:CCGGTCACACTAGACTTCGAATATGCTCGAGCATATTCGAAGTCTAGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-192s1c1
Sequence:CCGGCGTGTCCCTCAAGAACATTGTCTCGAGACAATGTTCTTGAGGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-1167s1c1
Sequence:CCGGCAACTACACCAAGCTGTACTACTCGAGTAGTACAGCTTGGTGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138353.2-492s1c1
Sequence:CCGGCAACGGGATGCTCATGAACATCTCGAGATGTTCATGAGCATCCCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172502
VALIDATED
DCAF15 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 15
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-2079s21c1
Sequence:CCGGGAGAGTCTGGATGTGTCTTTACTCGAGTAAAGACACATCCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-1351s21c1
Sequence:CCGGTTACCCTGGACTTCGAGTATGCTCGAGCATACTCGAAGTCCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172502.3-2079s1c1
Sequence:CCGGGAGAGTCTGGATGTGTCTTTACTCGAGTAAAGACACATCCAGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-1471s21c1
Sequence:CCGGACCAGGTCCTGATCAACATTGCTCGAGCAATGTTGATCAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172502.3-1579s21c1
Sequence:CCGGACCTCAACACAGGCATCTTTGCTCGAGCAAAGATGCCTGTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-313s21c1
Sequence:CCGGACGACTTCTCCTTCTACATATCTCGAGATATGTAGAAGGAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-476s1c1
Sequence:CCGGCAAGGTCATCGTGTTTGGTTTCTCGAGAAACCAAACACGATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-726s1c1
Sequence:CCGGGCCTTCCAACTCAAGAAGGATCTCGAGATCCTTCTTGAGTTGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-1180s1c1
Sequence:CCGGGCTACATCAATTACACCAAGTCTCGAGACTTGGTGTAATTGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172502
VALIDATED
DCAF15 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 15
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-2079s21c1
Sequence:CCGGGAGAGTCTGGATGTGTCTTTACTCGAGTAAAGACACATCCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-1351s21c1
Sequence:CCGGTTACCCTGGACTTCGAGTATGCTCGAGCATACTCGAAGTCCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172502.3-2079s1c1
Sequence:CCGGGAGAGTCTGGATGTGTCTTTACTCGAGTAAAGACACATCCAGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-1471s21c1
Sequence:CCGGACCAGGTCCTGATCAACATTGCTCGAGCAATGTTGATCAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172502.3-1579s21c1
Sequence:CCGGACCTCAACACAGGCATCTTTGCTCGAGCAAAGATGCCTGTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-313s21c1
Sequence:CCGGACGACTTCTCCTTCTACATATCTCGAGATATGTAGAAGGAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-476s1c1
Sequence:CCGGCAAGGTCATCGTGTTTGGTTTCTCGAGAAACCAAACACGATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-726s1c1
Sequence:CCGGGCCTTCCAACTCAAGAAGGATCTCGAGATCCTTCTTGAGTTGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-1180s1c1
Sequence:CCGGGCTACATCAATTACACCAAGTCTCGAGACTTGGTGTAATTGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172502
VALIDATED
DCAF15 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 15
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-2079s21c1
Sequence:CCGGGAGAGTCTGGATGTGTCTTTACTCGAGTAAAGACACATCCAGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-1351s21c1
Sequence:CCGGTTACCCTGGACTTCGAGTATGCTCGAGCATACTCGAAGTCCAGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172502.3-2079s1c1
Sequence:CCGGGAGAGTCTGGATGTGTCTTTACTCGAGTAAAGACACATCCAGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-1471s21c1
Sequence:CCGGACCAGGTCCTGATCAACATTGCTCGAGCAATGTTGATCAGGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172502.3-1579s21c1
Sequence:CCGGACCTCAACACAGGCATCTTTGCTCGAGCAAAGATGCCTGTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_172502.3-313s21c1
Sequence:CCGGACGACTTCTCCTTCTACATATCTCGAGATATGTAGAAGGAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192773    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-476s1c1
Sequence:CCGGCAAGGTCATCGTGTTTGGTTTCTCGAGAAACCAAACACGATGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-726s1c1
Sequence:CCGGGCCTTCCAACTCAAGAAGGATCTCGAGATCCTTCTTGAGTTGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172502.1-1180s1c1
Sequence:CCGGGCTACATCAATTACACCAAGTCTCGAGACTTGGTGTAATTGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks