EMAIL THIS PAGE TO A FRIEND

DCAF16

DDB1 and CUL4 associated factor 16

120 Gene Product Result for
Synonyms: C4orf30
UniProtKB ID: Q9NXF7
Gene ID:
naked mole-rat(101711026) DDB1 and CUL4 associated factor 16
sheep(101121517) DDB1 and CUL4 associated factor 16
dog(100683835) DDB1 and CUL4 associated factor 16
domestic cat(101085799) DDB1 and CUL4 associated factor 16
cow(777600) DDB1 and CUL4 associated factor 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017741 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130031 MISSION® esiRNA esiRNA human C4orf30 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017741 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087798 predicted 1188
2 SASI_Hs01_00087800 predicted 1624
3 SASI_Hs01_00087801 predicted 1517
4 SASI_Hs01_00087802 predicted 1635
5 SASI_Hs01_00087803 predicted 1309
6 SASI_Hs01_00087804 predicted 1348
7 SASI_Hs01_00087805 predicted 1478
8 SASI_Hs01_00087806 predicted 1505
9 SASI_Hs01_00087807 predicted 1344
10 SASI_Hs02_00350541 predicted 1324
11 SASI_Hs01_00087799 predicted 1469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017741
VALIDATED
DCAF16 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 16
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017741.2-1638s1c1
Sequence:CCGGGAACCCATCAACACCACTTATCTCGAGATAAGTGGTGTTGATGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1480s1c1
Sequence:CCGGCTCTAAATGGAGCACTGCAATCTCGAGATTGCAGTGCTCCATTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1641s1c1
Sequence:CCGGCCCATCAACACCACTTATTCTCTCGAGAGAATAAGTGGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017741.2-1155s1c1
Sequence:CCGGGAGTGGGATTCCTCTGAAGAACTCGAGTTCTTCAGAGGAATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1540s1c1
Sequence:CCGGCTCCCATACCTGAATACCTAACTCGAGTTAGGTATTCAGGTATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1508s1c1
Sequence:CCGGCAAACAGCTAAGCCGAACATTCTCGAGAATGTTCGGCTTAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1320s1c1
Sequence:CCGGGTCCATATACTTCGAGAGATACTCGAGTATCTCTCGAAGTATATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1098s1c1
Sequence:CCGGGAATCAGAAAGTGAGGAAGAACTCGAGTTCTTCCTCACTTTCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145306    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017741.2-2277s1c1
Sequence:CCGGCGTTTACAAAGTGGCATCAAACTCGAGTTTGATGCCACTTTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1278s21c1
Sequence:CCGGTCCTGGTTGTATCATGCTAAACTCGAGTTTAGCATGATACAACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1759s21c1
Sequence:CCGGGTGGTACAAAGTTAGTCATTACTCGAGTAATGACTAACTTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017741.3-1705s21c1
Sequence:CCGGCACTGTAAAGATCTACCATTTCTCGAGAAATGGTAGATCTTTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017741.3-1640s21c1
Sequence:CCGGACCCATCAACACTACTTATTCCTCGAGGAATAAGTAGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1180s21c1
Sequence:CCGGACTCTATGGTGCCCAACTTATCTCGAGATAAGTTGGGCACCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1308s21c1
Sequence:CCGGCCAAGCACACCAGTCCATATACTCGAGTATATGGACTGGTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017741
VALIDATED
DCAF16 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 16
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017741.2-1638s1c1
Sequence:CCGGGAACCCATCAACACCACTTATCTCGAGATAAGTGGTGTTGATGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1480s1c1
Sequence:CCGGCTCTAAATGGAGCACTGCAATCTCGAGATTGCAGTGCTCCATTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1641s1c1
Sequence:CCGGCCCATCAACACCACTTATTCTCTCGAGAGAATAAGTGGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017741.2-1155s1c1
Sequence:CCGGGAGTGGGATTCCTCTGAAGAACTCGAGTTCTTCAGAGGAATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1540s1c1
Sequence:CCGGCTCCCATACCTGAATACCTAACTCGAGTTAGGTATTCAGGTATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1508s1c1
Sequence:CCGGCAAACAGCTAAGCCGAACATTCTCGAGAATGTTCGGCTTAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1320s1c1
Sequence:CCGGGTCCATATACTTCGAGAGATACTCGAGTATCTCTCGAAGTATATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1098s1c1
Sequence:CCGGGAATCAGAAAGTGAGGAAGAACTCGAGTTCTTCCTCACTTTCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145306    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017741.2-2277s1c1
Sequence:CCGGCGTTTACAAAGTGGCATCAAACTCGAGTTTGATGCCACTTTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1278s21c1
Sequence:CCGGTCCTGGTTGTATCATGCTAAACTCGAGTTTAGCATGATACAACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1759s21c1
Sequence:CCGGGTGGTACAAAGTTAGTCATTACTCGAGTAATGACTAACTTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017741.3-1705s21c1
Sequence:CCGGCACTGTAAAGATCTACCATTTCTCGAGAAATGGTAGATCTTTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017741.3-1640s21c1
Sequence:CCGGACCCATCAACACTACTTATTCCTCGAGGAATAAGTAGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1180s21c1
Sequence:CCGGACTCTATGGTGCCCAACTTATCTCGAGATAAGTTGGGCACCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1308s21c1
Sequence:CCGGCCAAGCACACCAGTCCATATACTCGAGTATATGGACTGGTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017741
VALIDATED
DCAF16 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 16
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017741.2-1638s1c1
Sequence:CCGGGAACCCATCAACACCACTTATCTCGAGATAAGTGGTGTTGATGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1480s1c1
Sequence:CCGGCTCTAAATGGAGCACTGCAATCTCGAGATTGCAGTGCTCCATTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1641s1c1
Sequence:CCGGCCCATCAACACCACTTATTCTCTCGAGAGAATAAGTGGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017741.2-1155s1c1
Sequence:CCGGGAGTGGGATTCCTCTGAAGAACTCGAGTTCTTCAGAGGAATCCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1540s1c1
Sequence:CCGGCTCCCATACCTGAATACCTAACTCGAGTTAGGTATTCAGGTATGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1508s1c1
Sequence:CCGGCAAACAGCTAAGCCGAACATTCTCGAGAATGTTCGGCTTAGCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017741.2-1320s1c1
Sequence:CCGGGTCCATATACTTCGAGAGATACTCGAGTATCTCTCGAAGTATATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017741.2-1098s1c1
Sequence:CCGGGAATCAGAAAGTGAGGAAGAACTCGAGTTCTTCCTCACTTTCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145306    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017741.2-2277s1c1
Sequence:CCGGCGTTTACAAAGTGGCATCAAACTCGAGTTTGATGCCACTTTGTAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1278s21c1
Sequence:CCGGTCCTGGTTGTATCATGCTAAACTCGAGTTTAGCATGATACAACCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369870    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1759s21c1
Sequence:CCGGGTGGTACAAAGTTAGTCATTACTCGAGTAATGACTAACTTTGTACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017741.3-1705s21c1
Sequence:CCGGCACTGTAAAGATCTACCATTTCTCGAGAAATGGTAGATCTTTACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017741.3-1640s21c1
Sequence:CCGGACCCATCAACACTACTTATTCCTCGAGGAATAAGTAGTGTTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1180s21c1
Sequence:CCGGACTCTATGGTGCCCAACTTATCTCGAGATAAGTTGGGCACCATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_017741.3-1308s21c1
Sequence:CCGGCCAAGCACACCAGTCCATATACTCGAGTATATGGACTGGTGTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks