EMAIL THIS PAGE TO A FRIEND

DCAF17

DDB1 and CUL4 associated factor 17

127 Gene Product Result for
Synonyms: C2orf37
UniProtKB ID: Q5H9S7, B2RTW5, Q53TN3, Q9H908
Gene ID:
Human(80067) Summary: This gene encodes a nuclear transmembrane protein that associates with cullin 4A/damaged DNA binding protein 1 ubiquitin ligase complex. Mutations in this gene are associated with Woodhouse-Sakati syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(75763) DDB1 and CUL4 associated factor 17
Rat(499807) DDB1 and CUL4 associated factor 17
Zebrafish(558828) ddb1 and cul4 associated factor 17
dog(609326) DDB1 and CUL4 associated factor 17
Horse(100063621) DDB1 and CUL4 associated factor 17
cow(614170) DDB1 and CUL4 associated factor 17
domestic cat(101089030) DDB1 and CUL4 associated factor 17
chicken(424153) DDB1 and CUL4 associated factor 17
sheep(101116207) DDB1 and CUL4 associated factor 17
Domestic Rabbit(100345756) DDB1 and CUL4 associated factor 17
naked mole-rat(101700597) DDB1 and CUL4 associated factor 17
domestic guinea pig(100724246) DDB1 and CUL4 associated factor 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198005 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198005 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198005 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025000 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025000 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025000 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025000 Rosetta Predictions human pricing
XM_001060141 Rosetta Predictions rat pricing
XM_575147 Rosetta Predictions rat pricing
NM_198005 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172766 predicted 565
2 SASI_Hs01_00172767 predicted 614
3 SASI_Hs01_00172768 predicted 519
4 SASI_Hs01_00172769 predicted 721
5 SASI_Hs01_00172770 predicted 613
6 SASI_Hs01_00172771 predicted 971
7 SASI_Hs01_00172772 predicted 821
8 SASI_Hs01_00172773 predicted 1233
9 SASI_Hs01_00172774 predicted 1726
10 SASI_Hs01_00172775 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295488 predicted 933
2 SASI_Rn02_00295489 predicted 2239
3 SASI_Rn02_00295490 predicted 1492
4 SASI_Rn02_00295491 predicted 1198
5 SASI_Rn02_00295492 predicted 1535
6 SASI_Rn02_00295493 predicted 1624
7 SASI_Rn02_00295494 predicted 1343
8 SASI_Rn02_00295495 predicted 1945
9 SASI_Rn02_00295496 predicted 2035
10 SASI_Rn02_00295497 predicted 2130
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403162 predicted 1247
2 SASI_Rn02_00403163 predicted 1282
3 SASI_Rn02_00403164 predicted 1204
4 SASI_Rn02_00403165 predicted 1247
5 SASI_Rn02_00403166 predicted 1345
6 SASI_Rn02_00403167 predicted 1188
7 SASI_Rn02_00403168 predicted 1345
8 SASI_Rn02_00403169 predicted 1239
9 SASI_Rn02_00403170 predicted 1260
10 SASI_Rn02_00403171 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198005 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100049 predicted 463
2 SASI_Mm01_00100050 predicted 1172
3 SASI_Mm01_00100051 predicted 887
4 SASI_Mm01_00100052 predicted 266
5 SASI_Mm01_00100053 predicted 740
6 SASI_Mm01_00100054 predicted 1184
7 SASI_Mm01_00100055 predicted 927
8 SASI_Mm01_00100056 predicted 633
9 SASI_Mm01_00100057 predicted 1139
10 SASI_Mm02_00350709 predicted 480
11 SASI_Mm01_00100048 predicted 1054
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198005
VALIDATED
DCAF17 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 17
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000283093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-1163s21c1
Sequence:CCGGGAATCTGACTGGATCTATTTCCTCGAGGAAATAGATCCAGTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-475s21c1
Sequence:CCGGTCCTGACCCATCAGACTATAACTCGAGTTATAGTCTGATGGGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-1050s21c1
Sequence:CCGGACTACATCATCACGCCTAATACTCGAGTATTAGGCGTGATGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198005.1-260s21c1
Sequence:CCGGGTGTGCCAGGAGAGTACTAAACTCGAGTTTAGTACTCTCCTGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-522s21c1
Sequence:CCGGATAATTGGCTGCTTCGTATATCTCGAGATATACGAAGCAGCCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1051s1c1
Sequence:CCGGCTACATCATCACGCCTAATAACTCGAGTTATTAGGCGTGATGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-521s1c1
Sequence:CCGGCATAATTGGCTGCTTCGTATACTCGAGTATACGAAGCAGCCAATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-476s1c1
Sequence:CCGGCCTGACCCATCAGACTATAAACTCGAGTTTATAGTCTGATGGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-300s1c1
Sequence:CCGGCTCATTCCAAGTCACCTATAGCTCGAGCTATAGGTGACTTGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1163s1c1
Sequence:CCGGGAATCTGACTGGATCTATTTCCTCGAGGAAATAGATCCAGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1551s1c1
Sequence:CCGGCATGGGATGTGGTATGTATAACTCGAGTTATACATACCACATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198005
VALIDATED
DCAF17 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 17
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000283093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-1163s21c1
Sequence:CCGGGAATCTGACTGGATCTATTTCCTCGAGGAAATAGATCCAGTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-475s21c1
Sequence:CCGGTCCTGACCCATCAGACTATAACTCGAGTTATAGTCTGATGGGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-1050s21c1
Sequence:CCGGACTACATCATCACGCCTAATACTCGAGTATTAGGCGTGATGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198005.1-260s21c1
Sequence:CCGGGTGTGCCAGGAGAGTACTAAACTCGAGTTTAGTACTCTCCTGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-522s21c1
Sequence:CCGGATAATTGGCTGCTTCGTATATCTCGAGATATACGAAGCAGCCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1051s1c1
Sequence:CCGGCTACATCATCACGCCTAATAACTCGAGTTATTAGGCGTGATGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-521s1c1
Sequence:CCGGCATAATTGGCTGCTTCGTATACTCGAGTATACGAAGCAGCCAATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-476s1c1
Sequence:CCGGCCTGACCCATCAGACTATAAACTCGAGTTTATAGTCTGATGGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-300s1c1
Sequence:CCGGCTCATTCCAAGTCACCTATAGCTCGAGCTATAGGTGACTTGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1163s1c1
Sequence:CCGGGAATCTGACTGGATCTATTTCCTCGAGGAAATAGATCCAGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1551s1c1
Sequence:CCGGCATGGGATGTGGTATGTATAACTCGAGTTATACATACCACATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198005
VALIDATED
DCAF17 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 17
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000283093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-1163s21c1
Sequence:CCGGGAATCTGACTGGATCTATTTCCTCGAGGAAATAGATCCAGTCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-475s21c1
Sequence:CCGGTCCTGACCCATCAGACTATAACTCGAGTTATAGTCTGATGGGTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-1050s21c1
Sequence:CCGGACTACATCATCACGCCTAATACTCGAGTATTAGGCGTGATGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198005.1-260s21c1
Sequence:CCGGGTGTGCCAGGAGAGTACTAAACTCGAGTTTAGTACTCTCCTGGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198005.1-522s21c1
Sequence:CCGGATAATTGGCTGCTTCGTATATCTCGAGATATACGAAGCAGCCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1051s1c1
Sequence:CCGGCTACATCATCACGCCTAATAACTCGAGTTATTAGGCGTGATGATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-521s1c1
Sequence:CCGGCATAATTGGCTGCTTCGTATACTCGAGTATACGAAGCAGCCAATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-476s1c1
Sequence:CCGGCCTGACCCATCAGACTATAAACTCGAGTTTATAGTCTGATGGGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217283    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-300s1c1
Sequence:CCGGCTCATTCCAAGTCACCTATAGCTCGAGCTATAGGTGACTTGGAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1163s1c1
Sequence:CCGGGAATCTGACTGGATCTATTTCCTCGAGGAAATAGATCCAGTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198005.1-1551s1c1
Sequence:CCGGCATGGGATGTGGTATGTATAACTCGAGTTATACATACCACATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025000
DCAF17 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 17
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1269s1c1
Sequence:CCGGGATGTGACATATAGCCATGAACTCGAGTTCATGGCTATATGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1206s1c1
Sequence:CCGGCTGGATTTCCACTGTAATGAACTCGAGTTCATTACAGTGGAAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025000.1-2127s1c1
Sequence:CCGGGCATCCTGTTTAGCTCTTAATCTCGAGATTAAGAGCTAAACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1346s1c1
Sequence:CCGGCAGCTGCTATGTTTACCATATCTCGAGATATGGTAAACATAGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1170s1c1
Sequence:CCGGGCTGTTACTCAAATAGATGCTCTCGAGAGCATCTATTTGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-898s1c1
Sequence:CCGGCTGATGCTTCTGGTAGAATAACTCGAGTTATTCTACCAGAAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025000.1-1655s1c1
Sequence:CCGGGCTAGGTGGTAATGCAAATATCTCGAGATATTTGCATTACCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025000.1-2256s1c1
Sequence:CCGGGCAGTAGTTCTGTTTCCTGTACTCGAGTACAGGAAACAGAACTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-1246s1c1
Sequence:CCGGGCATTCCACTAGTGGAGTCATCTCGAGATGACTCCACTAGTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1092s1c1
Sequence:CCGGCTTCTGGATGATGACCCAGAACTCGAGTTCTGGGTCATCATCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-758s1c1
Sequence:CCGGGCACTACATCGTCACACCTAACTCGAGTTAGGTGTGACGATGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025000.1-1493s1c1
Sequence:CCGGGCATGGCACATTCTCCAGTATCTCGAGATACTGGAGAATGTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025000
DCAF17 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 17
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1269s1c1
Sequence:CCGGGATGTGACATATAGCCATGAACTCGAGTTCATGGCTATATGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1206s1c1
Sequence:CCGGCTGGATTTCCACTGTAATGAACTCGAGTTCATTACAGTGGAAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025000.1-2127s1c1
Sequence:CCGGGCATCCTGTTTAGCTCTTAATCTCGAGATTAAGAGCTAAACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1346s1c1
Sequence:CCGGCAGCTGCTATGTTTACCATATCTCGAGATATGGTAAACATAGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1170s1c1
Sequence:CCGGGCTGTTACTCAAATAGATGCTCTCGAGAGCATCTATTTGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-898s1c1
Sequence:CCGGCTGATGCTTCTGGTAGAATAACTCGAGTTATTCTACCAGAAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025000.1-1655s1c1
Sequence:CCGGGCTAGGTGGTAATGCAAATATCTCGAGATATTTGCATTACCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025000.1-2256s1c1
Sequence:CCGGGCAGTAGTTCTGTTTCCTGTACTCGAGTACAGGAAACAGAACTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-1246s1c1
Sequence:CCGGGCATTCCACTAGTGGAGTCATCTCGAGATGACTCCACTAGTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1092s1c1
Sequence:CCGGCTTCTGGATGATGACCCAGAACTCGAGTTCTGGGTCATCATCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-758s1c1
Sequence:CCGGGCACTACATCGTCACACCTAACTCGAGTTAGGTGTGACGATGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025000.1-1493s1c1
Sequence:CCGGGCATGGCACATTCTCCAGTATCTCGAGATACTGGAGAATGTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025000
DCAF17 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 17
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145572    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1269s1c1
Sequence:CCGGGATGTGACATATAGCCATGAACTCGAGTTCATGGCTATATGTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144311    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1206s1c1
Sequence:CCGGCTGGATTTCCACTGTAATGAACTCGAGTTCATTACAGTGGAAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145280    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025000.1-2127s1c1
Sequence:CCGGGCATCCTGTTTAGCTCTTAATCTCGAGATTAAGAGCTAAACAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145063    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1346s1c1
Sequence:CCGGCAGCTGCTATGTTTACCATATCTCGAGATATGGTAAACATAGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1170s1c1
Sequence:CCGGGCTGTTACTCAAATAGATGCTCTCGAGAGCATCTATTTGAGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-898s1c1
Sequence:CCGGCTGATGCTTCTGGTAGAATAACTCGAGTTATTCTACCAGAAGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025000.1-1655s1c1
Sequence:CCGGGCTAGGTGGTAATGCAAATATCTCGAGATATTTGCATTACCACCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143474    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025000.1-2256s1c1
Sequence:CCGGGCAGTAGTTCTGTTTCCTGTACTCGAGTACAGGAAACAGAACTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-1246s1c1
Sequence:CCGGGCATTCCACTAGTGGAGTCATCTCGAGATGACTCCACTAGTGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025000.1-1092s1c1
Sequence:CCGGCTTCTGGATGATGACCCAGAACTCGAGTTCTGGGTCATCATCCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025000.1-758s1c1
Sequence:CCGGGCACTACATCGTCACACCTAACTCGAGTTAGGTGTGACGATGTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025000.1-1493s1c1
Sequence:CCGGGCATGGCACATTCTCCAGTATCTCGAGATACTGGAGAATGTGCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks