EMAIL THIS PAGE TO A FRIEND

DCAF4

DDB1 and CUL4 associated factor 4

73 Gene Product Result for
Synonyms: WDR21 WDR21A
Gene ID:
Human(26094) Summary: This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Mouse(73828) DDB1 and CUL4 associated factor 4
Rat(362762) DDB1 and CUL4 associated factor 4
domestic guinea pig(100726951) DDB1 and CUL4 associated factor 4
naked mole-rat(101717702) DDB1 and CUL4 associated factor 4
sheep(101123126) DDB1 and CUL4 associated factor 4
chicken(423253) DDB1 and CUL4 associated factor 4
cow(511629) DDB1 and CUL4 associated factor 4
Horse(100050032) DDB1 and CUL4 associated factor 4
domestic cat(101085984) DDB1 and CUL4 associated factor 4
dog(490767) DDB1 and CUL4 associated factor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA047276 Anti-DCAF4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102694 Anti-WDR21A (ab1) antibody produced in rabbit affinity isolated antibody rat, human, canine, horse, rabbit, bovine, mouse
western blot pricing
SAB2102695 Anti-WDR21A (ab2) antibody produced in rabbit affinity isolated antibody guinea pig, bovine, canine, human, mouse, rat, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015604 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015604 Rosetta Predictions human pricing
NM_181340 Rosetta Predictions human pricing
NM_181341 Rosetta Predictions human pricing
NM_001108716 Rosetta Predictions rat pricing
NM_030246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136526 predicted 1817
2 SASI_Hs01_00136527 predicted 1687
3 SASI_Hs01_00136528 predicted 1817
4 SASI_Hs01_00136529 predicted 1682
5 SASI_Hs01_00136530 predicted 1698
6 SASI_Hs01_00136531 predicted 1832
7 SASI_Hs01_00136532 predicted 1750
8 SASI_Hs01_00136535 predicted 1375
9 SASI_Hs02_00348190 predicted 1770
10 SASI_Hs02_00348191 predicted 1814
11 SASI_Hs01_00136533 predicted 1688
12 SASI_Hs01_00136534 predicted 1686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113875 predicted 1711
2 SASI_Hs01_00113876 predicted 1592
3 SASI_Hs01_00113877 predicted 1718
4 SASI_Hs01_00113878 predicted 1587
5 SASI_Hs01_00113879 predicted 1590
6 SASI_Hs01_00113880 predicted 1733
7 SASI_Hs01_00113881 predicted 1643
8 SASI_Hs01_00113884 predicted 1274
9 SASI_Hs02_00369998 predicted 1668
10 SASI_Hs02_00369999 predicted 1711
11 SASI_Hs01_00113882 predicted 1586
12 SASI_Hs01_00113883 predicted 1580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074821 predicted 1298
2 SASI_Hs01_00074822 predicted 1173
3 SASI_Hs01_00074823 predicted 1311
4 SASI_Hs01_00074824 predicted 1179
5 SASI_Hs01_00074825 predicted 1184
6 SASI_Hs01_00074826 predicted 1327
7 SASI_Hs01_00074827 predicted 1238
8 SASI_Hs01_00074830 predicted 871
9 SASI_Hs02_00370000 predicted 1257
10 SASI_Hs02_00370001 predicted 1307
11 SASI_Hs01_00074828 predicted 1177
12 SASI_Hs01_00074829 predicted 1179
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108716 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241375 predicted 1143
2 SASI_Rn02_00241376 predicted 361
3 SASI_Rn02_00241377 predicted 200
4 SASI_Rn02_00241378 predicted 273
5 SASI_Rn02_00241379 predicted 249
6 SASI_Rn02_00241380 predicted 1594
7 SASI_Rn02_00241381 predicted 1222
8 SASI_Rn02_00241382 predicted 1693
9 SASI_Rn02_00241383 predicted 996
10 SASI_Rn02_00241384 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131719 predicted 1083
2 SASI_Mm01_00131720 predicted 1267
3 SASI_Mm01_00131721 predicted 848
4 SASI_Mm01_00131722 predicted 295
5 SASI_Mm01_00131723 predicted 1282
6 SASI_Mm01_00131724 predicted 1017
7 SASI_Mm01_00131725 predicted 943
8 SASI_Mm01_00131727 predicted 1120
9 SASI_Mm01_00131728 predicted 952
10 SASI_Mm02_00336711 predicted 979
11 SASI_Mm01_00131726 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030246
DCAF4 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-1275s1c1
Sequence:CCGGCACTAAATGTGTGAGACAGTACTCGAGTACTGTCTCACACATTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-483s1c1
Sequence:CCGGCTTCTCCAGTTATTGCCGTTTCTCGAGAAACGGCAATAACTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-944s1c1
Sequence:CCGGCCTTGAACGTCCAGGCAAATACTCGAGTATTTGCCTGGACGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030246.1-1755s21c1
Sequence:CCGGTCAATTCCCATCGACCAATAGCTCGAGCTATTGGTCGATGGGAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-945s21c1
Sequence:CCGGCTTGAACGTCCAGGCAAATAACTCGAGTTATTTGCCTGGACGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-485s21c1
Sequence:CCGGTCTCCAGTTATTGCCGTTTATCTCGAGATAAACGGCAATAACTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-573s21c1
Sequence:CCGGTCTGGCAAGTGACCGGTTTAACTCGAGTTAAACCGGTCACTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-1154s21c1
Sequence:CCGGGCTGGAAGGCTACCCAAATTTCTCGAGAAATTTGGGTAGCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030246
DCAF4 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-1275s1c1
Sequence:CCGGCACTAAATGTGTGAGACAGTACTCGAGTACTGTCTCACACATTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-483s1c1
Sequence:CCGGCTTCTCCAGTTATTGCCGTTTCTCGAGAAACGGCAATAACTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-944s1c1
Sequence:CCGGCCTTGAACGTCCAGGCAAATACTCGAGTATTTGCCTGGACGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030246.1-1755s21c1
Sequence:CCGGTCAATTCCCATCGACCAATAGCTCGAGCTATTGGTCGATGGGAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-945s21c1
Sequence:CCGGCTTGAACGTCCAGGCAAATAACTCGAGTTATTTGCCTGGACGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-485s21c1
Sequence:CCGGTCTCCAGTTATTGCCGTTTATCTCGAGATAAACGGCAATAACTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-573s21c1
Sequence:CCGGTCTGGCAAGTGACCGGTTTAACTCGAGTTAAACCGGTCACTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-1154s21c1
Sequence:CCGGGCTGGAAGGCTACCCAAATTTCTCGAGAAATTTGGGTAGCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030246
DCAF4 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-1275s1c1
Sequence:CCGGCACTAAATGTGTGAGACAGTACTCGAGTACTGTCTCACACATTTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190955    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-483s1c1
Sequence:CCGGCTTCTCCAGTTATTGCCGTTTCTCGAGAAACGGCAATAACTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030246.1-944s1c1
Sequence:CCGGCCTTGAACGTCCAGGCAAATACTCGAGTATTTGCCTGGACGTTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030246.1-1755s21c1
Sequence:CCGGTCAATTCCCATCGACCAATAGCTCGAGCTATTGGTCGATGGGAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-945s21c1
Sequence:CCGGCTTGAACGTCCAGGCAAATAACTCGAGTTATTTGCCTGGACGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-485s21c1
Sequence:CCGGTCTCCAGTTATTGCCGTTTATCTCGAGATAAACGGCAATAACTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-573s21c1
Sequence:CCGGTCTGGCAAGTGACCGGTTTAACTCGAGTTAAACCGGTCACTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030246.1-1154s21c1
Sequence:CCGGGCTGGAAGGCTACCCAAATTTCTCGAGAAATTTGGGTAGCCTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015604
VALIDATED
DCAF4 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015604.2-967s1c1
Sequence:CCGGCGTCAATAGTCACCCAGGAATCTCGAGATTCCTGGGTGACTATTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-1045s1c1
Sequence:CCGGGTCCCTGAATATCCAAGCAAACTCGAGTTTGCTTGGATATTCAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015604.2-1047s1c1
Sequence:CCGGCCCTGAATATCCAAGCAAATACTCGAGTATTTGCTTGGATATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-2360s1c1
Sequence:CCGGCGGTGACTTGAATGTCAGATTCTCGAGAATCTGACATTCAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015604.2-956s1c1
Sequence:CCGGGCATCACTGTTCGTCAATAGTCTCGAGACTATTGACGAACAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-2167s1c1
Sequence:CCGGGCTGGAGTTTGGAATCCTTAACTCGAGTTAAGGATTCCAAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015604.2-700s1c1
Sequence:CCGGCCTCATACTGGCAGATACCAACTCGAGTTGGTATCTGCCAGTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015604.3-570s21c1
Sequence:CCGGAGATTGCCAGGATGGGATTTACTCGAGTAAATCCCATCCTGGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015604.3-1738s21c1
Sequence:CCGGGATTTGACTTACGGGAGTAAACTCGAGTTTACTCCCGTAAGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015604
VALIDATED
DCAF4 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015604.2-967s1c1
Sequence:CCGGCGTCAATAGTCACCCAGGAATCTCGAGATTCCTGGGTGACTATTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-1045s1c1
Sequence:CCGGGTCCCTGAATATCCAAGCAAACTCGAGTTTGCTTGGATATTCAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015604.2-1047s1c1
Sequence:CCGGCCCTGAATATCCAAGCAAATACTCGAGTATTTGCTTGGATATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-2360s1c1
Sequence:CCGGCGGTGACTTGAATGTCAGATTCTCGAGAATCTGACATTCAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015604.2-956s1c1
Sequence:CCGGGCATCACTGTTCGTCAATAGTCTCGAGACTATTGACGAACAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-2167s1c1
Sequence:CCGGGCTGGAGTTTGGAATCCTTAACTCGAGTTAAGGATTCCAAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015604.2-700s1c1
Sequence:CCGGCCTCATACTGGCAGATACCAACTCGAGTTGGTATCTGCCAGTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015604.3-570s21c1
Sequence:CCGGAGATTGCCAGGATGGGATTTACTCGAGTAAATCCCATCCTGGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015604.3-1738s21c1
Sequence:CCGGGATTTGACTTACGGGAGTAAACTCGAGTTTACTCCCGTAAGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015604
VALIDATED
DCAF4 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015604.2-967s1c1
Sequence:CCGGCGTCAATAGTCACCCAGGAATCTCGAGATTCCTGGGTGACTATTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-1045s1c1
Sequence:CCGGGTCCCTGAATATCCAAGCAAACTCGAGTTTGCTTGGATATTCAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015604.2-1047s1c1
Sequence:CCGGCCCTGAATATCCAAGCAAATACTCGAGTATTTGCTTGGATATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-2360s1c1
Sequence:CCGGCGGTGACTTGAATGTCAGATTCTCGAGAATCTGACATTCAAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152743    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015604.2-956s1c1
Sequence:CCGGGCATCACTGTTCGTCAATAGTCTCGAGACTATTGACGAACAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153155    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015604.2-2167s1c1
Sequence:CCGGGCTGGAGTTTGGAATCCTTAACTCGAGTTAAGGATTCCAAACTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015604.2-700s1c1
Sequence:CCGGCCTCATACTGGCAGATACCAACTCGAGTTGGTATCTGCCAGTATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015604.3-570s21c1
Sequence:CCGGAGATTGCCAGGATGGGATTTACTCGAGTAAATCCCATCCTGGCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419932    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015604.3-1738s21c1
Sequence:CCGGGATTTGACTTACGGGAGTAAACTCGAGTTTACTCCCGTAAGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks