EMAIL THIS PAGE TO A FRIEND

DCAF4L1

DDB1 and CUL4 associated factor 4-like 1

19 Gene Product Result for
Synonyms: WDR21B
Species: Human DCAF4L1(285429)
UniProtKB ID: Q3SXM0, B3KVI3, Q3ZCW8, Q499Y5, Q9UFI0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029955 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029955 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029955 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138231 MISSION® esiRNA esiRNA human WDR21B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029955 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194454 predicted 1325
2 SASI_Hs01_00194455 predicted 1323
3 SASI_Hs01_00194459 predicted 677
4 SASI_Hs02_00307577 predicted 213
5 SASI_Hs01_00194457 predicted 1305
6 SASI_Hs01_00194458 predicted 1332
7 SASI_Hs01_00194460 predicted 603
8 SASI_Hs01_00194462 predicted 410
9 SASI_Hs02_00307578 predicted 746
10 SASI_Hs02_00307579 predicted 1319
11 SASI_Hs01_00194453 predicted 942
12 SASI_Hs01_00194456 predicted 924
13 SASI_Hs01_00194461 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029955
DCAF4L1 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 4-like 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-343s1c1
Sequence:CCGGCAGTCTGCGAACTCTGAAGATCTCGAGATCTTCAGAGTTCGCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-692s1c1
Sequence:CCGGCAGTCATTTGATACCAGCAGTCTCGAGACTGCTGGTATCAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029955.1-4386s1c1
Sequence:CCGGCCTCCATTTAACCCAAAGCAACTCGAGTTGCTTTGGGTTAAATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-89s1c1
Sequence:CCGGGTAGCCAGAATGGGATTTAATCTCGAGATTAAATCCCATTCTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-152s1c1
Sequence:CCGGGTCACCAGTTACTCCCGTTTACTCGAGTAAACGGGAGTAACTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029955
DCAF4L1 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 4-like 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-343s1c1
Sequence:CCGGCAGTCTGCGAACTCTGAAGATCTCGAGATCTTCAGAGTTCGCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-692s1c1
Sequence:CCGGCAGTCATTTGATACCAGCAGTCTCGAGACTGCTGGTATCAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029955.1-4386s1c1
Sequence:CCGGCCTCCATTTAACCCAAAGCAACTCGAGTTGCTTTGGGTTAAATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-89s1c1
Sequence:CCGGGTAGCCAGAATGGGATTTAATCTCGAGATTAAATCCCATTCTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-152s1c1
Sequence:CCGGGTCACCAGTTACTCCCGTTTACTCGAGTAAACGGGAGTAACTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029955
DCAF4L1 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 4-like 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-343s1c1
Sequence:CCGGCAGTCTGCGAACTCTGAAGATCTCGAGATCTTCAGAGTTCGCAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-692s1c1
Sequence:CCGGCAGTCATTTGATACCAGCAGTCTCGAGACTGCTGGTATCAAATGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029955.1-4386s1c1
Sequence:CCGGCCTCCATTTAACCCAAAGCAACTCGAGTTGCTTTGGGTTAAATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-89s1c1
Sequence:CCGGGTAGCCAGAATGGGATTTAATCTCGAGATTAAATCCCATTCTGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029955.1-152s1c1
Sequence:CCGGGTCACCAGTTACTCCCGTTTACTCGAGTAAACGGGAGTAACTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks