EMAIL THIS PAGE TO A FRIEND

DCAF4L2

DDB1 and CUL4 associated factor 4-like 2

34 Gene Product Result for
Synonyms: WDR21C
Species: Human DCAF4L2(138009)
UniProtKB ID: Q8NA75
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152418 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152418 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152418 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102261 MISSION® esiRNA esiRNA human WDR21C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152418 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233311 predicted 1321
2 SASI_Hs01_00233312 predicted 197
3 SASI_Hs01_00233313 predicted 987
4 SASI_Hs01_00233314 predicted 235
5 SASI_Hs01_00233315 predicted 749
6 SASI_Hs01_00233318 predicted 318
7 SASI_Hs01_00233319 predicted 208
8 SASI_Hs01_00233320 predicted 751
9 SASI_Hs02_00366139 predicted 193
10 SASI_Hs02_00366140 predicted 958
11 SASI_Hs01_00233316 predicted 995
12 SASI_Hs01_00233317 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152418
DCAF4L2 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 4-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1055s1c1
Sequence:CCGGGTGCATGTGAACGAAGAAGAACTCGAGTTCTTCTTCGTTCACATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152418.2-1338s1c1
Sequence:CCGGGCATCGTATTACCGTTTCTATCTCGAGATAGAAACGGTAATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1262s1c1
Sequence:CCGGCTTTATTGTTTCTCCTACGGTCTCGAGACCGTAGGAGAAACAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-790s1c1
Sequence:CCGGGTTTGCAATCATGACTCCTTTCTCGAGAAAGGAGTCATGATTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152418.2-2646s1c1
Sequence:CCGGCCTGACTATGAGAAGTAGAAACTCGAGTTTCTACTTCTCATAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1010s1c1
Sequence:CCGGGTAACACAGTACGAAGGTCATCTCGAGATGACCTTCGTACTGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-461s1c1
Sequence:CCGGGTCCCTAATCGGAAGGTGAATCTCGAGATTCACCTTCCGATTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-272s1c1
Sequence:CCGGGTCCAGATTCATAGCTGGGATCTCGAGATCCCAGCTATGAATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152418.3-1267s21c1
Sequence:CCGGTTGTTTCTCCTACGGTTAATTCTCGAGAATTAACCGTAGGAGAAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152418.3-1308s21c1
Sequence:CCGGGAACGTGGATTTGACTTAAAGCTCGAGCTTTAAGTCAAATCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152418.3-319s21c1
Sequence:CCGGTAACCGCATACTGGCGAATACCTCGAGGTATTCGCCAGTATGCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152418
DCAF4L2 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 4-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1055s1c1
Sequence:CCGGGTGCATGTGAACGAAGAAGAACTCGAGTTCTTCTTCGTTCACATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152418.2-1338s1c1
Sequence:CCGGGCATCGTATTACCGTTTCTATCTCGAGATAGAAACGGTAATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1262s1c1
Sequence:CCGGCTTTATTGTTTCTCCTACGGTCTCGAGACCGTAGGAGAAACAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-790s1c1
Sequence:CCGGGTTTGCAATCATGACTCCTTTCTCGAGAAAGGAGTCATGATTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152418.2-2646s1c1
Sequence:CCGGCCTGACTATGAGAAGTAGAAACTCGAGTTTCTACTTCTCATAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1010s1c1
Sequence:CCGGGTAACACAGTACGAAGGTCATCTCGAGATGACCTTCGTACTGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-461s1c1
Sequence:CCGGGTCCCTAATCGGAAGGTGAATCTCGAGATTCACCTTCCGATTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-272s1c1
Sequence:CCGGGTCCAGATTCATAGCTGGGATCTCGAGATCCCAGCTATGAATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152418.3-1267s21c1
Sequence:CCGGTTGTTTCTCCTACGGTTAATTCTCGAGAATTAACCGTAGGAGAAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152418.3-1308s21c1
Sequence:CCGGGAACGTGGATTTGACTTAAAGCTCGAGCTTTAAGTCAAATCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152418.3-319s21c1
Sequence:CCGGTAACCGCATACTGGCGAATACCTCGAGGTATTCGCCAGTATGCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152418
DCAF4L2 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 4-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152958    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1055s1c1
Sequence:CCGGGTGCATGTGAACGAAGAAGAACTCGAGTTCTTCTTCGTTCACATGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152418.2-1338s1c1
Sequence:CCGGGCATCGTATTACCGTTTCTATCTCGAGATAGAAACGGTAATACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150343    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1262s1c1
Sequence:CCGGCTTTATTGTTTCTCCTACGGTCTCGAGACCGTAGGAGAAACAATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-790s1c1
Sequence:CCGGGTTTGCAATCATGACTCCTTTCTCGAGAAAGGAGTCATGATTGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152035    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152418.2-2646s1c1
Sequence:CCGGCCTGACTATGAGAAGTAGAAACTCGAGTTTCTACTTCTCATAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152511    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152418.2-1010s1c1
Sequence:CCGGGTAACACAGTACGAAGGTCATCTCGAGATGACCTTCGTACTGTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-461s1c1
Sequence:CCGGGTCCCTAATCGGAAGGTGAATCTCGAGATTCACCTTCCGATTAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152418.2-272s1c1
Sequence:CCGGGTCCAGATTCATAGCTGGGATCTCGAGATCCCAGCTATGAATCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152418.3-1267s21c1
Sequence:CCGGTTGTTTCTCCTACGGTTAATTCTCGAGAATTAACCGTAGGAGAAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152418.3-1308s21c1
Sequence:CCGGGAACGTGGATTTGACTTAAAGCTCGAGCTTTAAGTCAAATCCACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152418.3-319s21c1
Sequence:CCGGTAACCGCATACTGGCGAATACCTCGAGGTATTCGCCAGTATGCGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks