EMAIL THIS PAGE TO A FRIEND

DCAF5

DDB1 and CUL4 associated factor 5

213 Gene Product Result for
Synonyms: BCRG2 BCRP2 D14S1461E WDR22
UniProtKB ID: Q96JK2, B2RN31, O60559, Q8N3V3, Q8N3V5
Gene ID:
Mouse(320808) DDB1 and CUL4 associated factor 5
Rat(314273) DDB1 and CUL4 associated factor 5
Zebrafish(560257) ddb1 and cul4 associated factor 5
chicken(428876) DDB1 and CUL4 associated factor 5
domestic cat(101098547) DDB1 and CUL4 associated factor 5
cow(785849) DDB1 and CUL4 associated factor 5
Horse(100063741) DDB1 and CUL4 associated factor 5
dog(490749) DDB1 and CUL4 associated factor 5
sheep(101117336) DDB1 and CUL4 associated factor 5
naked mole-rat(101711468) DDB1 and CUL4 associated factor 5
domestic guinea pig(100713665) DDB1 and CUL4 associated factor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003861 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177267 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177267 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177267 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003861 Rosetta Predictions human pricing
XM_001080939 Rosetta Predictions rat pricing
XM_234345 Rosetta Predictions rat pricing
NM_177267 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076632 predicted 2008
2 SASI_Hs01_00076633 predicted 405
3 SASI_Hs01_00076634 predicted 929
4 SASI_Hs01_00076635 predicted 2032
5 SASI_Hs01_00076636 predicted 2170
6 SASI_Hs01_00076637 predicted 1876
7 SASI_Hs01_00076638 predicted 450
8 SASI_Hs01_00076639 predicted 477
9 SASI_Hs01_00076640 predicted 536
10 SASI_Hs01_00076641 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369930 predicted 1383
2 SASI_Rn02_00369931 predicted 3347
3 SASI_Rn02_00369932 predicted 3167
4 SASI_Rn02_00369933 predicted 1312
5 SASI_Rn02_00369934 predicted 3312
6 SASI_Rn02_00369935 predicted 766
7 SASI_Rn02_00369936 predicted 2529
8 SASI_Rn02_00369937 predicted 2498
9 SASI_Rn02_00369938 predicted 946
10 SASI_Rn02_00369939 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388402 predicted 1383
2 SASI_Rn02_00388403 predicted 3344
3 SASI_Rn02_00388404 predicted 3158
4 SASI_Rn02_00388405 predicted 1308
5 SASI_Rn02_00388406 predicted 3315
6 SASI_Rn02_00388407 predicted 766
7 SASI_Rn02_00388408 predicted 2531
8 SASI_Rn02_00388409 predicted 2501
9 SASI_Rn02_00388410 predicted 940
10 SASI_Rn02_00388411 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177267 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044329 predicted 2146
2 SASI_Mm02_00347307 predicted 1741
3 SASI_Mm01_00044330 predicted 2973
4 SASI_Mm01_00044331 predicted 392
5 SASI_Mm01_00044332 predicted 956
6 SASI_Mm01_00044333 predicted 2940
7 SASI_Mm01_00044334 predicted 497
8 SASI_Mm01_00044335 predicted 1037
9 SASI_Mm01_00044336 predicted 797
10 SASI_Mm01_00044337 predicted 504
11 SASI_Mm01_00044338 predicted 1963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003861
DCAF5 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-2811s21c1
Sequence:CCGGCTCAGACACTGACCGTGATAACTCGAGTTATCACGGTCAGTGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003861.2-3378s21c1
Sequence:CCGGATGGCACGTGTGCGCTTATTGCTCGAGCAATAAGCGCACACGTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-1224s21c1
Sequence:CCGGTGTTAACCAAGTCCGATTTAACTCGAGTTAAATCGGACTTGGTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-1083s21c1
Sequence:CCGGAGGAGATCGTGACCAGTATATCTCGAGATATACTGGTCACGATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-2862s21c1
Sequence:CCGGAGATTGTTGCGGGTCTGAAATCTCGAGATTTCAGACCCGCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003861.1-5008s1c1
Sequence:CCGGCGGATACATATCTTCCTGAAACTCGAGTTTCAGGAAGATATGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-3365s1c1
Sequence:CCGGGCCAGTGAGTTGTAGATTTATCTCGAGATAAATCTACAACTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-619s1c1
Sequence:CCGGGCCTTTCATAGTGTCATGTTTCTCGAGAAACATGACACTATGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-5416s1c1
Sequence:CCGGCCCAACTTTGATGGCACATTTCTCGAGAAATGTGCCATCAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-5417s1c1
Sequence:CCGGCCAACTTTGATGGCACATTTACTCGAGTAAATGTGCCATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-2055s1c1
Sequence:CCGGCCGCTACTCTTATATCTCCTACTCGAGTAGGAGATATAAGAGTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-852s1c1
Sequence:CCGGGCCTGTGTTTCAGTTTGACAACTCGAGTTGTCAAACTGAAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003861.1-3762s1c1
Sequence:CCGGGCATAGTGAAAGAAGGGCAAACTCGAGTTTGCCCTTCTTTCACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003861
DCAF5 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-2811s21c1
Sequence:CCGGCTCAGACACTGACCGTGATAACTCGAGTTATCACGGTCAGTGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003861.2-3378s21c1
Sequence:CCGGATGGCACGTGTGCGCTTATTGCTCGAGCAATAAGCGCACACGTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-1224s21c1
Sequence:CCGGTGTTAACCAAGTCCGATTTAACTCGAGTTAAATCGGACTTGGTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-1083s21c1
Sequence:CCGGAGGAGATCGTGACCAGTATATCTCGAGATATACTGGTCACGATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-2862s21c1
Sequence:CCGGAGATTGTTGCGGGTCTGAAATCTCGAGATTTCAGACCCGCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003861.1-5008s1c1
Sequence:CCGGCGGATACATATCTTCCTGAAACTCGAGTTTCAGGAAGATATGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-3365s1c1
Sequence:CCGGGCCAGTGAGTTGTAGATTTATCTCGAGATAAATCTACAACTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-619s1c1
Sequence:CCGGGCCTTTCATAGTGTCATGTTTCTCGAGAAACATGACACTATGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-5416s1c1
Sequence:CCGGCCCAACTTTGATGGCACATTTCTCGAGAAATGTGCCATCAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-5417s1c1
Sequence:CCGGCCAACTTTGATGGCACATTTACTCGAGTAAATGTGCCATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-2055s1c1
Sequence:CCGGCCGCTACTCTTATATCTCCTACTCGAGTAGGAGATATAAGAGTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-852s1c1
Sequence:CCGGGCCTGTGTTTCAGTTTGACAACTCGAGTTGTCAAACTGAAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003861.1-3762s1c1
Sequence:CCGGGCATAGTGAAAGAAGGGCAAACTCGAGTTTGCCCTTCTTTCACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003861
DCAF5 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-2811s21c1
Sequence:CCGGCTCAGACACTGACCGTGATAACTCGAGTTATCACGGTCAGTGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003861.2-3378s21c1
Sequence:CCGGATGGCACGTGTGCGCTTATTGCTCGAGCAATAAGCGCACACGTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-1224s21c1
Sequence:CCGGTGTTAACCAAGTCCGATTTAACTCGAGTTAAATCGGACTTGGTTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-1083s21c1
Sequence:CCGGAGGAGATCGTGACCAGTATATCTCGAGATATACTGGTCACGATCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003861.2-2862s21c1
Sequence:CCGGAGATTGTTGCGGGTCTGAAATCTCGAGATTTCAGACCCGCAACAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150046    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003861.1-5008s1c1
Sequence:CCGGCGGATACATATCTTCCTGAAACTCGAGTTTCAGGAAGATATGTATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147371    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-3365s1c1
Sequence:CCGGGCCAGTGAGTTGTAGATTTATCTCGAGATAAATCTACAACTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-619s1c1
Sequence:CCGGGCCTTTCATAGTGTCATGTTTCTCGAGAAACATGACACTATGAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146480    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-5416s1c1
Sequence:CCGGCCCAACTTTGATGGCACATTTCTCGAGAAATGTGCCATCAAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003861.1-5417s1c1
Sequence:CCGGCCAACTTTGATGGCACATTTACTCGAGTAAATGTGCCATCAAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-2055s1c1
Sequence:CCGGCCGCTACTCTTATATCTCCTACTCGAGTAGGAGATATAAGAGTAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003861.1-852s1c1
Sequence:CCGGGCCTGTGTTTCAGTTTGACAACTCGAGTTGTCAAACTGAAACACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127994    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003861.1-3762s1c1
Sequence:CCGGGCATAGTGAAAGAAGGGCAAACTCGAGTTTGCCCTTCTTTCACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177267
DCAF5 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-948s1c1
Sequence:CCGGCCAGTTTGACAATCAGGGTTACTCGAGTAACCCTGATTGTCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-497s1c1
Sequence:CCGGGAGGAAATGATGAGCAAGTTACTCGAGTAACTTGCTCATCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177267.3-3338s1c1
Sequence:CCGGCCATCAGCAAAGACCTGTGAACTCGAGTTCACAGGTCTTTGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-302s1c1
Sequence:CCGGGCTGTGTCAATGCCATTGAATCTCGAGATTCAATGGCATTGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-1729s1c1
Sequence:CCGGGAGTCCGATTCTGAAGAGAATCTCGAGATTCTCTTCAGAATCGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177267
DCAF5 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-948s1c1
Sequence:CCGGCCAGTTTGACAATCAGGGTTACTCGAGTAACCCTGATTGTCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-497s1c1
Sequence:CCGGGAGGAAATGATGAGCAAGTTACTCGAGTAACTTGCTCATCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177267.3-3338s1c1
Sequence:CCGGCCATCAGCAAAGACCTGTGAACTCGAGTTCACAGGTCTTTGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-302s1c1
Sequence:CCGGGCTGTGTCAATGCCATTGAATCTCGAGATTCAATGGCATTGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-1729s1c1
Sequence:CCGGGAGTCCGATTCTGAAGAGAATCTCGAGATTCTCTTCAGAATCGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177267
DCAF5 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-948s1c1
Sequence:CCGGCCAGTTTGACAATCAGGGTTACTCGAGTAACCCTGATTGTCAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-497s1c1
Sequence:CCGGGAGGAAATGATGAGCAAGTTACTCGAGTAACTTGCTCATCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177267.3-3338s1c1
Sequence:CCGGCCATCAGCAAAGACCTGTGAACTCGAGTTCACAGGTCTTTGCTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-302s1c1
Sequence:CCGGGCTGTGTCAATGCCATTGAATCTCGAGATTCAATGGCATTGACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177267.3-1729s1c1
Sequence:CCGGGAGTCCGATTCTGAAGAGAATCTCGAGATTCTCTTCAGAATCGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks