EMAIL THIS PAGE TO A FRIEND

DCAF6

DDB1 and CUL4 associated factor 6

121 Gene Product Result for
Synonyms: 1200006M05Rik ARCAP IQWD1 MSTP055 NRIP PC326
UniProtKB ID: Q58WW2, A2A295, B4DNB8, Q7L8I0, Q8IXH3, Q8TB19
Gene ID:
Mouse(74106) DDB1 and CUL4 associated factor 6
Rat(289181) DDB1 and CUL4 associated factor 6
domestic guinea pig(100713643) DDB1 and CUL4 associated factor 6
naked mole-rat(101726615) DDB1 and CUL4 associated factor 6
sheep(101116363) DDB1 and CUL4 associated factor 6
Domestic Rabbit(100350015) DDB1 and CUL4 associated factor 6
Zebrafish(564498) ddb1 and cul4 associated factor 6
chicken(418438) DDB1 and CUL4 associated factor 6
cow(524645) DDB1 and CUL4 associated factor 6
Horse(100057094) DDB1 and CUL4 associated factor 6
domestic cat(101099610) DDB1 and CUL4 associated factor 6
dog(480085) DDB1 and CUL4 associated factor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_917541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_917541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_917541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017977 Rosetta Predictions human pricing
NM_018442 Rosetta Predictions human pricing
XM_001071288 Rosetta Predictions rat pricing
XM_213926 Rosetta Predictions rat pricing
XM_917541 Rosetta Predictions mouse pricing
XM_976438 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306864 predicted 645
2 SASI_Hs02_00306865 predicted 2491
3 SASI_Hs01_00014544 predicted 661
4 SASI_Hs01_00014545 predicted 522
5 SASI_Hs01_00014546 predicted 911
6 SASI_Hs01_00014547 predicted 2564
7 SASI_Hs01_00014548 predicted 2346
8 SASI_Hs01_00014549 predicted 686
9 SASI_Hs01_00014550 predicted 1005
10 SASI_Hs01_00014551 predicted 674
11 SASI_Hs01_00014543 predicted 1916
12 SASI_Hs01_00014552 predicted 2062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351972 predicted 641
2 SASI_Hs02_00351973 predicted 2553
3 SASI_Hs01_00076913 predicted 658
4 SASI_Hs01_00076914 predicted 521
5 SASI_Hs01_00076915 predicted 908
6 SASI_Hs01_00076916 predicted 2629
7 SASI_Hs01_00076917 predicted 2405
8 SASI_Hs01_00076918 predicted 684
9 SASI_Hs01_00076919 predicted 1007
10 SASI_Hs01_00076920 predicted 674
11 SASI_Hs01_00076912 predicted 1981
12 SASI_Hs01_00076921 predicted 2120
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334530 predicted 622
2 SASI_Rn02_00334531 predicted 2328
3 SASI_Rn02_00334532 predicted 425
4 SASI_Rn02_00334533 predicted 2353
5 SASI_Rn02_00334534 predicted 878
6 SASI_Rn02_00334535 predicted 606
7 SASI_Rn02_00334536 predicted 929
8 SASI_Rn02_00334537 predicted 438
9 SASI_Rn02_00334538 predicted 1552
10 SASI_Rn02_00334539 predicted 2342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375016 predicted 625
2 SASI_Rn02_00375017 predicted 2325
3 SASI_Rn02_00375018 predicted 424
4 SASI_Rn02_00375019 predicted 2355
5 SASI_Rn02_00375020 predicted 878
6 SASI_Rn02_00375021 predicted 601
7 SASI_Rn02_00375022 predicted 933
8 SASI_Rn02_00375023 predicted 440
9 SASI_Rn02_00375024 predicted 1558
10 SASI_Rn02_00375025 predicted 2343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441253 predicted 1145
2 SASI_Mm02_00441254 predicted 773
3 SASI_Mm02_00441255 predicted 944
4 SASI_Mm02_00441256 predicted 454
5 SASI_Mm02_00441257 predicted 2604
6 SASI_Mm02_00441258 predicted 445
7 SASI_Mm02_00441259 predicted 1814
8 SASI_Mm02_00441260 predicted 998
9 SASI_Mm02_00441261 predicted 1831
10 SASI_Mm02_00441262 predicted 2642
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00446011 predicted 1147
2 SASI_Mm01_00234806 predicted 776
3 SASI_Mm01_00234807 predicted 941
4 SASI_Mm01_00234808 predicted 456
5 SASI_Mm01_00234809 predicted 2603
6 SASI_Mm01_00234810 predicted 450
7 SASI_Mm01_00234811 predicted 1816
8 SASI_Mm01_00234812 predicted 997
9 SASI_Mm01_00234813 predicted 1827
10 SASI_Mm02_00446012 predicted 2642
11 SASI_Mm01_00234814 predicted 2777
12 SASI_Mm01_00234815 predicted 337
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018442
DCAF6 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-943s1c1
Sequence:CCGGCCCTCATTCTACTCCTTTGCTCTCGAGAGCAAAGGAGTAGAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1331s1c1
Sequence:CCGGCCTGAAGAATCATCAGAGGATCTCGAGATCCTCTGATGATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-867s1c1
Sequence:CCGGCTGAACAATTTCTTCAGCCTTCTCGAGAAGGCTGAAGAAATTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1536s1c1
Sequence:CCGGCAGAAACTTCAGATCAGACTACTCGAGTAGTCTGATCTGAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1967s1c1
Sequence:CCGGGAGCATTTGATGCTTCTGGAACTCGAGTTCCAGAAGCATCAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-2125s21c1
Sequence:CCGGCAGAAACTTCAGATCAGACTACTCGAGTAGTCTGATCTGAAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-1532s21c1
Sequence:CCGGCCCTCATTCTACTCCTTTGCTCTCGAGAGCAAAGGAGTAGAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-2556s21c1
Sequence:CCGGGAGCATTTGATGCTTCTGGAACTCGAGTTCCAGAAGCATCAAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-1456s21c1
Sequence:CCGGCTGAACAATTTCTTCAGCCTTCTCGAGAAGGCTGAAGAAATTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018442
DCAF6 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-943s1c1
Sequence:CCGGCCCTCATTCTACTCCTTTGCTCTCGAGAGCAAAGGAGTAGAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1331s1c1
Sequence:CCGGCCTGAAGAATCATCAGAGGATCTCGAGATCCTCTGATGATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-867s1c1
Sequence:CCGGCTGAACAATTTCTTCAGCCTTCTCGAGAAGGCTGAAGAAATTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1536s1c1
Sequence:CCGGCAGAAACTTCAGATCAGACTACTCGAGTAGTCTGATCTGAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1967s1c1
Sequence:CCGGGAGCATTTGATGCTTCTGGAACTCGAGTTCCAGAAGCATCAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-2125s21c1
Sequence:CCGGCAGAAACTTCAGATCAGACTACTCGAGTAGTCTGATCTGAAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-1532s21c1
Sequence:CCGGCCCTCATTCTACTCCTTTGCTCTCGAGAGCAAAGGAGTAGAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-2556s21c1
Sequence:CCGGGAGCATTTGATGCTTCTGGAACTCGAGTTCCAGAAGCATCAAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-1456s21c1
Sequence:CCGGCTGAACAATTTCTTCAGCCTTCTCGAGAAGGCTGAAGAAATTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018442
DCAF6 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-943s1c1
Sequence:CCGGCCCTCATTCTACTCCTTTGCTCTCGAGAGCAAAGGAGTAGAATGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1331s1c1
Sequence:CCGGCCTGAAGAATCATCAGAGGATCTCGAGATCCTCTGATGATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-867s1c1
Sequence:CCGGCTGAACAATTTCTTCAGCCTTCTCGAGAAGGCTGAAGAAATTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1536s1c1
Sequence:CCGGCAGAAACTTCAGATCAGACTACTCGAGTAGTCTGATCTGAAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018442.1-1967s1c1
Sequence:CCGGGAGCATTTGATGCTTCTGGAACTCGAGTTCCAGAAGCATCAAATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-2125s21c1
Sequence:CCGGCAGAAACTTCAGATCAGACTACTCGAGTAGTCTGATCTGAAGTTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-1532s21c1
Sequence:CCGGCCCTCATTCTACTCCTTTGCTCTCGAGAGCAAAGGAGTAGAATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-2556s21c1
Sequence:CCGGGAGCATTTGATGCTTCTGGAACTCGAGTTCCAGAAGCATCAAATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018442.2-1456s21c1
Sequence:CCGGCTGAACAATTTCTTCAGCCTTCTCGAGAAGGCTGAAGAAATTGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_917541
DCAF6 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-875s21c1
Sequence:CCGGGACAGCTCAGTACGGATTTATCTCGAGATAAATCCGTACTGAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-2767s21c1
Sequence:CCGGGTTGGCGTCACTGAATCATATCTCGAGATATGATTCAGTGACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-1393s21c1
Sequence:CCGGGGTTCCATCAAGTCCTAATTTCTCGAGAAATTAGGACTTGATGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-952s21c1
Sequence:CCGGTGGAATGGTTGCTCGATTTATCTCGAGATAAATCGAGCAACCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_917541.3-2890s21c1
Sequence:CCGGTGAGATTTGTATACGACATTTCTCGAGAAATGTCGTATACAAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_917541
DCAF6 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-875s21c1
Sequence:CCGGGACAGCTCAGTACGGATTTATCTCGAGATAAATCCGTACTGAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-2767s21c1
Sequence:CCGGGTTGGCGTCACTGAATCATATCTCGAGATATGATTCAGTGACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-1393s21c1
Sequence:CCGGGGTTCCATCAAGTCCTAATTTCTCGAGAAATTAGGACTTGATGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-952s21c1
Sequence:CCGGTGGAATGGTTGCTCGATTTATCTCGAGATAAATCGAGCAACCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_917541.3-2890s21c1
Sequence:CCGGTGAGATTTGTATACGACATTTCTCGAGAAATGTCGTATACAAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_917541
DCAF6 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-875s21c1
Sequence:CCGGGACAGCTCAGTACGGATTTATCTCGAGATAAATCCGTACTGAGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-2767s21c1
Sequence:CCGGGTTGGCGTCACTGAATCATATCTCGAGATATGATTCAGTGACGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-1393s21c1
Sequence:CCGGGGTTCCATCAAGTCCTAATTTCTCGAGAAATTAGGACTTGATGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_917541.3-952s21c1
Sequence:CCGGTGGAATGGTTGCTCGATTTATCTCGAGATAAATCGAGCAACCATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_917541.3-2890s21c1
Sequence:CCGGTGAGATTTGTATACGACATTTCTCGAGAAATGTCGTATACAAATCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks