EMAIL THIS PAGE TO A FRIEND

DCAF7

DDB1 and CUL4 associated factor 7

250 Gene Product Result for
Synonyms: AN11 HAN11 SWAN-1 WDR68
UniProtKB ID: P61962, D3DU14, O15491, Q9DAE4
Gene ID:
Human(10238) Summary: This gene encodes a protein with multiple WD40 repeats which facilitate protein-protein interactions and thereby enable the assembly of multiprotein complexes. This protein has been shown to function as a scaffold protein for protein complexes involved in kinase signalling. This highly conserved gene is present in eukaryotic plants, fungi, and animals. The ortholog of this gene was first identified in plants as a key regulator of anthocyanin biosynthesis and flower pigmentation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(71833) DDB1 and CUL4 associated factor 7
Rat(303602) DDB1 and CUL4 associated factor 7
Zebrafish(337565) ddb1 and cul4 associated factor 7
chicken(771554) DDB1 and CUL4 associated factor 7
dog(612958) DDB1 and CUL4 associated factor 7
domestic cat(101094640) DDB1 and CUL4 associated factor 7
cow(516678) DDB1 and CUL4 associated factor 7
Horse(100054273) DDB1 and CUL4 associated factor 7
sheep(101102573) DDB1 and CUL4 associated factor 7
naked mole-rat(101703478) DDB1 and CUL4 associated factor 7
domestic guinea pig(100715499) DDB1 and CUL4 associated factor 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005828 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027946 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027946 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027946 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003725 Rosetta Predictions human pricing
NM_005828 Rosetta Predictions human pricing
NM_001107057 Rosetta Predictions rat pricing
XM_221032 Rosetta Predictions rat pricing
NM_027946 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066317 predicted 900
2 SASI_Hs01_00066318 predicted 297
3 SASI_Hs01_00066319 predicted 680
4 SASI_Hs01_00066320 predicted 743
5 SASI_Hs01_00066321 predicted 953
6 SASI_Hs01_00066322 predicted 432
7 SASI_Hs01_00066323 predicted 915
8 SASI_Hs01_00066324 predicted 595
9 SASI_Hs01_00066325 predicted 743
10 SASI_Hs01_00066326 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235016 predicted 896
2 SASI_Hs01_00235017 predicted 299
3 SASI_Hs01_00235018 predicted 678
4 SASI_Hs01_00235019 predicted 740
5 SASI_Hs01_00235020 predicted 944
6 SASI_Hs02_00340358 predicted 1332
7 SASI_Hs01_00235021 predicted 421
8 SASI_Hs02_00340359 predicted 1211
9 SASI_Hs02_00340360 predicted 1152
10 SASI_Hs01_00235022 predicted 908
11 SASI_Hs01_00235023 predicted 594
12 SASI_Hs01_00235024 predicted 749
13 SASI_Hs01_00235025 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225066 predicted 601
2 SASI_Rn02_00225067 predicted 509
3 SASI_Rn02_00225068 predicted 484
4 SASI_Rn02_00225069 predicted 242
5 SASI_Rn02_00225070 predicted 1099
6 SASI_Rn02_00225071 predicted 1135
7 SASI_Rn02_00225072 predicted 734
8 SASI_Rn02_00225073 predicted 1063
9 SASI_Rn02_00225074 predicted 382
10 SASI_Rn02_00225075 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175421 predicted 1362
2 SASI_Rn01_00175422 predicted 631
3 SASI_Rn01_00175423 predicted 1370
4 SASI_Rn01_00175424 predicted 877
5 SASI_Rn01_00175425 predicted 422
6 SASI_Rn01_00175426 predicted 418
7 SASI_Rn01_00175427 predicted 728
8 SASI_Rn01_00175428 predicted 461
9 SASI_Rn01_00175429 predicted 411
10 SASI_Rn01_00175430 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027946 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195687 predicted 931
2 SASI_Mm01_00195689 predicted 1257
3 SASI_Mm01_00195690 predicted 1247
4 SASI_Mm01_00195691 predicted 1186
5 SASI_Mm02_00332955 predicted 750
6 SASI_Mm01_00195693 predicted 744
7 SASI_Mm01_00195694 predicted 995
8 SASI_Mm01_00195695 predicted 1091
9 SASI_Mm01_00195696 predicted 465
10 SASI_Mm02_00332956 predicted 949
11 SASI_Mm01_00195688 predicted 752
12 SASI_Mm01_00195692 predicted 429
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005828
VALIDATED
DCAF7 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 7
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-535s21c1
Sequence:CCGGGCTGGAGTGTTTGCTAAACAACTCGAGTTGTTTAGCAAACACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-848s21c1
Sequence:CCGGCACAGCACCATCATTTACGAACTCGAGTTCGTAAATGATGGTGCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-1151s21c1
Sequence:CCGGGCTGAAGGAGAGATCAACAATCTCGAGATTGTTGATCTCTCCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-356s21c1
Sequence:CCGGGTTCAGCTTGTTGGTTTAGATCTCGAGATCTAAACCAACAAGCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-586s1c1
Sequence:CCGGGCCCATGACAAAGAGGTCTATCTCGAGATAGACCTCTTTGTCATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-850s1c1
Sequence:CCGGGCCAGGTTAAACAACCATCGACTCGAGTCGATGGTTGTTTAACCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-390s1c1
Sequence:CCGGGCTGGAGTGTTTGCTAAACAACTCGAGTTGTTTAGCAAACACTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005828.1-220s1c1
Sequence:CCGGGTTGGTTTAGATGAGGAGAGTCTCGAGACTCTCCTCATCTAAACCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-1006s1c1
Sequence:CCGGGCTGAAGGAGAGATCAACAATCTCGAGATTGTTGATCTCTCCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-193s1c1
Sequence:CCGGGAGGAGTACAACAACAAGGTTCTCGAGAACCTTGTTGTTGTACTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-703s1c1
Sequence:CCGGCACAGCACCATCATTTACGAACTCGAGTTCGTAAATGATGGTGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-211s1c1
Sequence:CCGGGTTCAGCTTGTTGGTTTAGATCTCGAGATCTAAACCAACAAGCTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005828
VALIDATED
DCAF7 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 7
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-535s21c1
Sequence:CCGGGCTGGAGTGTTTGCTAAACAACTCGAGTTGTTTAGCAAACACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-848s21c1
Sequence:CCGGCACAGCACCATCATTTACGAACTCGAGTTCGTAAATGATGGTGCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-1151s21c1
Sequence:CCGGGCTGAAGGAGAGATCAACAATCTCGAGATTGTTGATCTCTCCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-356s21c1
Sequence:CCGGGTTCAGCTTGTTGGTTTAGATCTCGAGATCTAAACCAACAAGCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-586s1c1
Sequence:CCGGGCCCATGACAAAGAGGTCTATCTCGAGATAGACCTCTTTGTCATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-850s1c1
Sequence:CCGGGCCAGGTTAAACAACCATCGACTCGAGTCGATGGTTGTTTAACCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-390s1c1
Sequence:CCGGGCTGGAGTGTTTGCTAAACAACTCGAGTTGTTTAGCAAACACTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005828.1-220s1c1
Sequence:CCGGGTTGGTTTAGATGAGGAGAGTCTCGAGACTCTCCTCATCTAAACCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-1006s1c1
Sequence:CCGGGCTGAAGGAGAGATCAACAATCTCGAGATTGTTGATCTCTCCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-193s1c1
Sequence:CCGGGAGGAGTACAACAACAAGGTTCTCGAGAACCTTGTTGTTGTACTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-703s1c1
Sequence:CCGGCACAGCACCATCATTTACGAACTCGAGTTCGTAAATGATGGTGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-211s1c1
Sequence:CCGGGTTCAGCTTGTTGGTTTAGATCTCGAGATCTAAACCAACAAGCTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005828
VALIDATED
DCAF7 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 7
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-535s21c1
Sequence:CCGGGCTGGAGTGTTTGCTAAACAACTCGAGTTGTTTAGCAAACACTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-848s21c1
Sequence:CCGGCACAGCACCATCATTTACGAACTCGAGTTCGTAAATGATGGTGCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-1151s21c1
Sequence:CCGGGCTGAAGGAGAGATCAACAATCTCGAGATTGTTGATCTCTCCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005828.3-356s21c1
Sequence:CCGGGTTCAGCTTGTTGGTTTAGATCTCGAGATCTAAACCAACAAGCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-586s1c1
Sequence:CCGGGCCCATGACAAAGAGGTCTATCTCGAGATAGACCTCTTTGTCATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-850s1c1
Sequence:CCGGGCCAGGTTAAACAACCATCGACTCGAGTCGATGGTTGTTTAACCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-390s1c1
Sequence:CCGGGCTGGAGTGTTTGCTAAACAACTCGAGTTGTTTAGCAAACACTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005828.1-220s1c1
Sequence:CCGGGTTGGTTTAGATGAGGAGAGTCTCGAGACTCTCCTCATCTAAACCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-1006s1c1
Sequence:CCGGGCTGAAGGAGAGATCAACAATCTCGAGATTGTTGATCTCTCCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005828.1-193s1c1
Sequence:CCGGGAGGAGTACAACAACAAGGTTCTCGAGAACCTTGTTGTTGTACTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-703s1c1
Sequence:CCGGCACAGCACCATCATTTACGAACTCGAGTTCGTAAATGATGGTGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005828.1-211s1c1
Sequence:CCGGGTTCAGCTTGTTGGTTTAGATCTCGAGATCTAAACCAACAAGCTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027946
VALIDATED
DCAF7 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027946.3-5363s1c1
Sequence:CCGGCGCATGTGTATGACCTGACTTCTCGAGAAGTCAGGTCATACACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-1236s1c1
Sequence:CCGGGATCGCTATCTGCTACAACAACTCGAGTTGTTGTAGCAGATAGCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-756s1c1
Sequence:CCGGCCAGCTAATTGCCCATGACAACTCGAGTTGTCATGGGCAATTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-484s1c1
Sequence:CCGGCCTGACACAAAGGGCGTCTATCTCGAGATAGACGCCCTTTGTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027946.3-588s1c1
Sequence:CCGGCAACAACAAGAACTCAGACTTCTCGAGAAGTCTGAGTTCTTGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027946
VALIDATED
DCAF7 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027946.3-5363s1c1
Sequence:CCGGCGCATGTGTATGACCTGACTTCTCGAGAAGTCAGGTCATACACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-1236s1c1
Sequence:CCGGGATCGCTATCTGCTACAACAACTCGAGTTGTTGTAGCAGATAGCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-756s1c1
Sequence:CCGGCCAGCTAATTGCCCATGACAACTCGAGTTGTCATGGGCAATTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-484s1c1
Sequence:CCGGCCTGACACAAAGGGCGTCTATCTCGAGATAGACGCCCTTTGTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027946.3-588s1c1
Sequence:CCGGCAACAACAAGAACTCAGACTTCTCGAGAAGTCTGAGTTCTTGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027946
VALIDATED
DCAF7 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114646    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027946.3-5363s1c1
Sequence:CCGGCGCATGTGTATGACCTGACTTCTCGAGAAGTCAGGTCATACACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-1236s1c1
Sequence:CCGGGATCGCTATCTGCTACAACAACTCGAGTTGTTGTAGCAGATAGCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-756s1c1
Sequence:CCGGCCAGCTAATTGCCCATGACAACTCGAGTTGTCATGGGCAATTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027946.3-484s1c1
Sequence:CCGGCCTGACACAAAGGGCGTCTATCTCGAGATAGACGCCCTTTGTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027946.3-588s1c1
Sequence:CCGGCAACAACAAGAACTCAGACTTCTCGAGAAGTCTGAGTTCTTGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)