EMAIL THIS PAGE TO A FRIEND

DCAF8

DDB1 and CUL4 associated factor 8

214 Gene Product Result for
Synonyms: H326 WDR42A
Gene ID:
Human(50717) Summary: This gene encodes a WD repeat-containing protein that interacts with the Cul4-Ddb1 E3 ligase macromolecular complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2009]
Mouse(98193) DDB1 and CUL4 associated factor 8
Rat(364050) DDB1 and CUL4 associated factor 8
domestic guinea pig(100730616) DDB1 and CUL4 associated factor 8
naked mole-rat(101719307) DDB1 and CUL4 associated factor 8
sheep(101119172) DDB1 and CUL4 associated factor 8
chicken(429253) DDB1 and CUL4 associated factor 8
dog(478971) DDB1 and CUL4 associated factor 8
cow(510316) DDB1 and CUL4 associated factor 8
Horse(100053669) DDB1 and CUL4 associated factor 8
domestic cat(101095310) DDB1 and CUL4 associated factor 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015726 Rosetta Predictions human pricing
NM_001014231 Rosetta Predictions rat pricing
NM_153555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119217 predicted 1450
2 SASI_Hs01_00119218 predicted 1171
3 SASI_Hs01_00119219 predicted 756
4 SASI_Hs01_00119220 predicted 745
5 SASI_Hs01_00119221 predicted 852
6 SASI_Hs02_00348416 predicted 1266
7 SASI_Hs01_00119223 predicted 983
8 SASI_Hs01_00119225 predicted 745
9 SASI_Hs01_00119226 predicted 1442
10 SASI_Hs02_00348417 predicted 756
11 SASI_Hs01_00119222 predicted 1181
12 SASI_Hs01_00119224 predicted 2052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101103 predicted 919
2 SASI_Rn01_00101104 predicted 849
3 SASI_Rn01_00101106 predicted 1132
4 SASI_Rn01_00101108 predicted 743
5 SASI_Rn02_00201772 predicted 1579
6 SASI_Rn01_00101109 predicted 1551
7 SASI_Rn01_00101110 predicted 786
8 SASI_Rn01_00101105 predicted 718
9 SASI_Rn01_00101111 predicted 1759
10 SASI_Rn01_00101112 predicted 1473
11 SASI_Rn01_00101107 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092165 predicted 1836
2 SASI_Mm01_00092166 predicted 801
3 SASI_Mm01_00092167 predicted 1279
4 SASI_Mm01_00092168 predicted 1767
5 SASI_Mm01_00092169 predicted 345
6 SASI_Mm01_00092170 predicted 808
7 SASI_Mm01_00092171 predicted 1512
8 SASI_Mm01_00092172 predicted 499
9 SASI_Mm01_00092173 predicted 1185
10 SASI_Mm02_00343336 predicted 1262
11 SASI_Mm01_00092164 predicted 1781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015726
DCAF8 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015726.2-3305s1c1
Sequence:CCGGCCATCCAACTTCATGCCAGTTCTCGAGAACTGGCATGAAGTTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015726.2-205s1c1
Sequence:CCGGGAACAGACTTAGCTAATGGAACTCGAGTTCCATTAGCTAAGTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-745s21c1
Sequence:CCGGGCCATACTGGTTGTGTCAATACTCGAGTATTGACACAACCAGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-201s21c1
Sequence:CCGGGGCAGAACAGACTTAGCTAATCTCGAGATTAGCTAAGTCTGTTCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015726.2-2764s21c1
Sequence:CCGGTCACTGTTAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTAACAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-1054s21c1
Sequence:CCGGACTCTCCCTGTACGTTCTTATCTCGAGATAAGAACGTACAGGGAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-414s21c1
Sequence:CCGGATGGAGGACACTGGTCATTACCTCGAGGTAATGACCAGTGTCCTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015726
DCAF8 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015726.2-3305s1c1
Sequence:CCGGCCATCCAACTTCATGCCAGTTCTCGAGAACTGGCATGAAGTTGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015726.2-205s1c1
Sequence:CCGGGAACAGACTTAGCTAATGGAACTCGAGTTCCATTAGCTAAGTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-745s21c1
Sequence:CCGGGCCATACTGGTTGTGTCAATACTCGAGTATTGACACAACCAGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-201s21c1
Sequence:CCGGGGCAGAACAGACTTAGCTAATCTCGAGATTAGCTAAGTCTGTTCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015726.2-2764s21c1
Sequence:CCGGTCACTGTTAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTAACAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-1054s21c1
Sequence:CCGGACTCTCCCTGTACGTTCTTATCTCGAGATAAGAACGTACAGGGAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-414s21c1
Sequence:CCGGATGGAGGACACTGGTCATTACCTCGAGGTAATGACCAGTGTCCTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015726
DCAF8 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172323    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015726.2-3305s1c1
Sequence:CCGGCCATCCAACTTCATGCCAGTTCTCGAGAACTGGCATGAAGTTGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167447    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015726.2-205s1c1
Sequence:CCGGGAACAGACTTAGCTAATGGAACTCGAGTTCCATTAGCTAAGTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-745s21c1
Sequence:CCGGGCCATACTGGTTGTGTCAATACTCGAGTATTGACACAACCAGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-201s21c1
Sequence:CCGGGGCAGAACAGACTTAGCTAATCTCGAGATTAGCTAAGTCTGTTCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015726.2-2764s21c1
Sequence:CCGGTCACTGTTAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTAACAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-1054s21c1
Sequence:CCGGACTCTCCCTGTACGTTCTTATCTCGAGATAAGAACGTACAGGGAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015726.2-414s21c1
Sequence:CCGGATGGAGGACACTGGTCATTACCTCGAGGTAATGACCAGTGTCCTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153555
VALIDATED
DCAF8 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 8
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153555.1-2150s1c1
Sequence:CCGGGCCCTTACATTCAACAGAAATCTCGAGATTTCTGTTGAATGTAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153555.1-1337s1c1
Sequence:CCGGGAGATCAGTATGTAAGGATTTCTCGAGAAATCCTTACATACTGATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153555.1-335s1c1
Sequence:CCGGGAACAGATTTAGCAAATGGAACTCGAGTTCCATTTGCTAAATCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153555.2-491s21c1
Sequence:CCGGTGGAGGACACGGGCCATTATTCTCGAGAATAATGGCCCGTGTCCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153555.2-800s21c1
Sequence:CCGGGCCATACTGGTTGTGTCAATACTCGAGTATTGACACAACCAGTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153555.2-1619s21c1
Sequence:CCGGAGTCATCTTGCCAGATTATTCCTCGAGGAATAATCTGGCAAGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153555.2-3203s21c1
Sequence:CCGGTCTCCTGGTTCTGAGTATAACCTCGAGGTTATACTCAGAACCAGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153555.2-1285s21c1
Sequence:CCGGGATCAGTATGTAAGGATTTATCTCGAGATAAATCCTTACATACTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153555
VALIDATED
DCAF8 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 8
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153555.1-2150s1c1
Sequence:CCGGGCCCTTACATTCAACAGAAATCTCGAGATTTCTGTTGAATGTAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153555.1-1337s1c1
Sequence:CCGGGAGATCAGTATGTAAGGATTTCTCGAGAAATCCTTACATACTGATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153555.1-335s1c1
Sequence:CCGGGAACAGATTTAGCAAATGGAACTCGAGTTCCATTTGCTAAATCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153555.2-491s21c1
Sequence:CCGGTGGAGGACACGGGCCATTATTCTCGAGAATAATGGCCCGTGTCCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153555.2-800s21c1
Sequence:CCGGGCCATACTGGTTGTGTCAATACTCGAGTATTGACACAACCAGTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153555.2-1619s21c1
Sequence:CCGGAGTCATCTTGCCAGATTATTCCTCGAGGAATAATCTGGCAAGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153555.2-3203s21c1
Sequence:CCGGTCTCCTGGTTCTGAGTATAACCTCGAGGTTATACTCAGAACCAGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153555.2-1285s21c1
Sequence:CCGGGATCAGTATGTAAGGATTTATCTCGAGATAAATCCTTACATACTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153555
VALIDATED
DCAF8 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 8
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201225    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153555.1-2150s1c1
Sequence:CCGGGCCCTTACATTCAACAGAAATCTCGAGATTTCTGTTGAATGTAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153555.1-1337s1c1
Sequence:CCGGGAGATCAGTATGTAAGGATTTCTCGAGAAATCCTTACATACTGATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191554    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153555.1-335s1c1
Sequence:CCGGGAACAGATTTAGCAAATGGAACTCGAGTTCCATTTGCTAAATCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153555.2-491s21c1
Sequence:CCGGTGGAGGACACGGGCCATTATTCTCGAGAATAATGGCCCGTGTCCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153555.2-800s21c1
Sequence:CCGGGCCATACTGGTTGTGTCAATACTCGAGTATTGACACAACCAGTATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_153555.2-1619s21c1
Sequence:CCGGAGTCATCTTGCCAGATTATTCCTCGAGGAATAATCTGGCAAGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153555.2-3203s21c1
Sequence:CCGGTCTCCTGGTTCTGAGTATAACCTCGAGGTTATACTCAGAACCAGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153555.2-1285s21c1
Sequence:CCGGGATCAGTATGTAAGGATTTATCTCGAGATAAATCCTTACATACTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)