EMAIL THIS PAGE TO A FRIEND

DCAF8L1

DDB1 and CUL4 associated factor 8-like 1

38 Gene Product Result for
Synonyms: WDR42B
Species: Human DCAF8L1(139425)
UniProtKB ID: A6NGE4, B3KXX1
Gene ID:
Human(139425) Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by Gly-His and Trp-Asp (GH-WD), which may facilitate the formation of heterotrimeric or multi-protein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene appears to represent an intronless retrocopy of a related multi-exon gene located on chromosome 1. However, the CDS of this intronless gene remains intact, it is conserved in other primate species, it is known to be transcribed, and it is therefore thought to encode a functional protein. [provided by RefSeq, May 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017930 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017930 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123930 predicted 1028
2 SASI_Hs01_00123931 predicted 1479
3 SASI_Hs01_00123932 predicted 1420
4 SASI_Hs01_00123933 predicted 1136
5 SASI_Hs01_00123934 predicted 1114
6 SASI_Hs01_00123935 predicted 930
7 SASI_Hs01_00123936 predicted 1140
8 SASI_Hs01_00123937 predicted 1707
9 SASI_Hs01_00123938 predicted 1712
10 SASI_Hs01_00123939 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017930
DCAF8L1 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 8-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017930.1-1946s1c1
Sequence:CCGGCCACCTAAGTACACTGGACTTCTCGAGAAGTCCAGTGTACTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1380s1c1
Sequence:CCGGGTGATGGTGCTCAATATGTTACTCGAGTAACATATTGAGCACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1712s1c1
Sequence:CCGGGATGAAGACAACTTGAACTATCTCGAGATAGTTCAAGTTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1120s1c1
Sequence:CCGGCGGACTGTATACAATCTCTATCTCGAGATAGAGATTGTATACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017930.1-1829s1c1
Sequence:CCGGCCAGATGAAGAAGAGTTGGATCTCGAGATCCAACTCTTCTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-703s1c1
Sequence:CCGGCGGTTCTGTCAGTACCATACACTCGAGTGTATGGTACTGACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017930.1-2522s1c1
Sequence:CCGGCCAGAGGAGAATTGATGAGAACTCGAGTTCTCATCAATTCTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017930.1-680s1c1
Sequence:CCGGCAGTATCTTCTTGGAAGCCATCTCGAGATGGCTTCCAAGAAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017930
DCAF8L1 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 8-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017930.1-1946s1c1
Sequence:CCGGCCACCTAAGTACACTGGACTTCTCGAGAAGTCCAGTGTACTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1380s1c1
Sequence:CCGGGTGATGGTGCTCAATATGTTACTCGAGTAACATATTGAGCACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1712s1c1
Sequence:CCGGGATGAAGACAACTTGAACTATCTCGAGATAGTTCAAGTTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1120s1c1
Sequence:CCGGCGGACTGTATACAATCTCTATCTCGAGATAGAGATTGTATACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017930.1-1829s1c1
Sequence:CCGGCCAGATGAAGAAGAGTTGGATCTCGAGATCCAACTCTTCTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-703s1c1
Sequence:CCGGCGGTTCTGTCAGTACCATACACTCGAGTGTATGGTACTGACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017930.1-2522s1c1
Sequence:CCGGCCAGAGGAGAATTGATGAGAACTCGAGTTCTCATCAATTCTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017930.1-680s1c1
Sequence:CCGGCAGTATCTTCTTGGAAGCCATCTCGAGATGGCTTCCAAGAAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017930
DCAF8L1 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 8-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001017930.1-1946s1c1
Sequence:CCGGCCACCTAAGTACACTGGACTTCTCGAGAAGTCCAGTGTACTTAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1380s1c1
Sequence:CCGGGTGATGGTGCTCAATATGTTACTCGAGTAACATATTGAGCACCATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1712s1c1
Sequence:CCGGGATGAAGACAACTTGAACTATCTCGAGATAGTTCAAGTTGTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-1120s1c1
Sequence:CCGGCGGACTGTATACAATCTCTATCTCGAGATAGAGATTGTATACAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017930.1-1829s1c1
Sequence:CCGGCCAGATGAAGAAGAGTTGGATCTCGAGATCCAACTCTTCTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017930.1-703s1c1
Sequence:CCGGCGGTTCTGTCAGTACCATACACTCGAGTGTATGGTACTGACAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142954    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001017930.1-2522s1c1
Sequence:CCGGCCAGAGGAGAATTGATGAGAACTCGAGTTCTCATCAATTCTCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017930.1-680s1c1
Sequence:CCGGCAGTATCTTCTTGGAAGCCATCTCGAGATGGCTTCCAAGAAGATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks