EMAIL THIS PAGE TO A FRIEND

DCAF8L2

DDB1 and CUL4 associated factor 8-like 2

40 Gene Product Result for
Synonyms: WDR42C
UniProtKB ID: P0C7V8, B2RXH9, J3KT06
Gene ID:
dog(491793) DDB1 and CUL4 associated factor 8-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301035 ANTI-WDR42C (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001136533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001136533 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715194 Rosetta Predictions human pricing
XM_293354 Rosetta Predictions human pricing
XM_942624 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00402062 predicted 1970
2 SASI_Hs02_00402063 predicted 603
3 SASI_Hs02_00402064 predicted 2119
4 SASI_Hs02_00402065 predicted 2147
5 SASI_Hs02_00402066 predicted 1852
6 SASI_Hs02_00402067 predicted 1935
7 SASI_Hs02_00402068 predicted 1381
8 SASI_Hs02_00402069 predicted 1834
9 SASI_Hs02_00402070 predicted 2253
10 SASI_Hs02_00402071 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_293354 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297192 predicted 1975
2 SASI_Hs02_00479149 predicted 605
3 SASI_Hs01_00297193 predicted 2122
4 SASI_Hs01_00297194 predicted 2144
5 SASI_Hs02_00479150 predicted 1848
6 SASI_Hs02_00479151 predicted 1930
7 SASI_Hs02_00479152 predicted 1834
8 SASI_Hs02_00479153 predicted 119
9 SASI_Hs02_00479154 predicted 413
10 SASI_Hs02_00479155 predicted 200
11 SASI_Hs01_00297195 predicted 1547
12 SASI_Hs01_00297196 predicted 1403
13 SASI_Hs01_00297197 predicted 1682
14 SASI_Hs01_00297198 predicted 1470
15 SASI_Hs01_00297199 predicted 1707
16 SASI_Hs01_00297200 predicted 1405
17 SASI_Hs01_00297201 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_942624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00485568 predicted 1975
2 SASI_Hs02_00485569 predicted 601
3 SASI_Hs02_00485570 predicted 2124
4 SASI_Hs02_00485571 predicted 2144
5 SASI_Hs02_00485572 predicted 1850
6 SASI_Hs02_00485573 predicted 1930
7 SASI_Hs02_00485574 predicted 1389
8 SASI_Hs02_00485575 predicted 1843
9 SASI_Hs02_00485576 predicted 2258
10 SASI_Hs02_00485577 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136533
DCAF8L2 MISSION shRNA Bacterial Glycerol Stock
DDB1 and CUL4 associated factor 8-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-820s21c1
Sequence:CCGGAGTAGCGGTGATGACCTAAAGCTCGAGCTTTAGGTCATCACCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1741s21c1
Sequence:CCGGGGGTTAAAGAAGGTGATTAAGCTCGAGCTTAATCACCTTCTTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1615s21c1
Sequence:CCGGGGGAGCAGAGAAGGTACAATACTCGAGTATTGTACCTTCTCTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1495s21c1
Sequence:CCGGACCACAGTCAAAGGTGTTAATCTCGAGATTAACACCTTTGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1212s21c1
Sequence:CCGGTCCCGCCAATACCTACCAATTCTCGAGAATTGGTAGGTATTGGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136533
DCAF8L2 MISSION shRNA shRNA Plasmid DNA
DDB1 and CUL4 associated factor 8-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-820s21c1
Sequence:CCGGAGTAGCGGTGATGACCTAAAGCTCGAGCTTTAGGTCATCACCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1741s21c1
Sequence:CCGGGGGTTAAAGAAGGTGATTAAGCTCGAGCTTAATCACCTTCTTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1615s21c1
Sequence:CCGGGGGAGCAGAGAAGGTACAATACTCGAGTATTGTACCTTCTCTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1495s21c1
Sequence:CCGGACCACAGTCAAAGGTGTTAATCTCGAGATTAACACCTTTGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1212s21c1
Sequence:CCGGTCCCGCCAATACCTACCAATTCTCGAGAATTGGTAGGTATTGGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136533
DCAF8L2 MISSION shRNA Lentiviral Transduction Particles
DDB1 and CUL4 associated factor 8-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-820s21c1
Sequence:CCGGAGTAGCGGTGATGACCTAAAGCTCGAGCTTTAGGTCATCACCGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1741s21c1
Sequence:CCGGGGGTTAAAGAAGGTGATTAAGCTCGAGCTTAATCACCTTCTTTAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1615s21c1
Sequence:CCGGGGGAGCAGAGAAGGTACAATACTCGAGTATTGTACCTTCTCTGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1495s21c1
Sequence:CCGGACCACAGTCAAAGGTGTTAATCTCGAGATTAACACCTTTGACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001136533.1-1212s21c1
Sequence:CCGGTCCCGCCAATACCTACCAATTCTCGAGAATTGGTAGGTATTGGCGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks