EMAIL THIS PAGE TO A FRIEND

DCAKD

dephospho-CoA kinase domain containing

53 Gene Product Result for
UniProtKB ID: Q8WVC6, A8K3Z0, D3DX60, D3DX62, Q9BR71, Q9H5W1
Gene ID:
Mouse(68087) dephospho-CoA kinase domain containing
Rat(360639) dephospho-CoA kinase domain containing
Zebrafish(751733) dephospho-CoA kinase domain containing
cow(508778) dephospho-CoA kinase domain containing
domestic cat(101082449) dephospho-CoA kinase domain containing
dog(490930) dephospho-CoA kinase domain containing
chicken(419967) dephospho-CoA kinase domain containing
sheep(101117519) dephospho-CoA kinase domain containing
naked mole-rat(101706552) dephospho-CoA kinase domain containing
domestic guinea pig(100725182) dephospho-CoA kinase domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024819 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075771 MISSION® esiRNA esiRNA human DCAKD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024819 Rosetta Predictions human pricing
NM_001007724 Rosetta Predictions rat pricing
NM_026551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357383 predicted 397
2 SASI_Hs01_00100730 predicted 677
3 SASI_Hs01_00100732 predicted 616
4 SASI_Hs01_00100733 predicted 324
5 SASI_Hs01_00100734 predicted 1390
6 SASI_Hs01_00100735 predicted 1304
7 SASI_Hs01_00100736 predicted 564
8 SASI_Hs01_00100737 predicted 1371
9 SASI_Hs01_00100738 predicted 1360
10 SASI_Hs01_00100739 predicted 1389
11 SASI_Hs01_00100731 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00051667 predicted 1218
2 SASI_Rn01_00051668 predicted 1133
3 SASI_Rn02_00198910 predicted 1096
4 SASI_Rn01_00051669 predicted 599
5 SASI_Rn01_00051670 predicted 1222
6 SASI_Rn01_00051672 predicted 1264
7 SASI_Rn01_00051673 predicted 525
8 SASI_Rn01_00051674 predicted 900
9 SASI_Rn01_00051675 predicted 1236
10 SASI_Rn01_00051676 predicted 1095
11 SASI_Rn01_00051671 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116223 predicted 758
2 SASI_Mm01_00116224 predicted 650
3 SASI_Mm01_00116225 predicted 627
4 SASI_Mm02_00330477 predicted 772
5 SASI_Mm01_00116226 predicted 575
6 SASI_Mm02_00330478 predicted 399
7 SASI_Mm02_00330479 predicted 213
8 SASI_Mm01_00116227 predicted 300
9 SASI_Mm01_00116228 predicted 579
10 SASI_Mm01_00116229 predicted 685
11 SASI_Mm01_00116230 predicted 393
12 SASI_Mm01_00116231 predicted 559
13 SASI_Mm01_00116232 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024819
VALIDATED
DCAKD MISSION shRNA Bacterial Glycerol Stock
dephospho-CoA kinase domain containing
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024819.4-505s21c1
Sequence:GTACCGGTGCTGGAGAACGGCGACATAACTCGAGTTATGTCGCCGTTCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-713s21c1
Sequence:CCGGGAAGCACACCGTGGTAGTATACTCGAGTATACTACCACGGTGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1220s21c1
Sequence:CCGGCTTTGGAGTGTATCCTATTTGCTCGAGCAAATAGGATACACTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1404s21c1
Sequence:GTACCGGAGGGTTCACTGGGCTTGAATCCTCGAGGATTCAAGCCCAGTGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1491s21c1
Sequence:CCGGCAAGGGTTTCCATGTTCAAACCTCGAGGTTTGAACATGGAAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024819.3-419s1c1
Sequence:CCGGGCTGGAGAATGGCGACATAAACTCGAGTTTATGTCGCCATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-590s1c1
Sequence:CCGGCCTGCTGTTTGAGACCAAGAACTCGAGTTCTTGGTCTCAAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-997s1c1
Sequence:CCGGGCCAGGTAACACATCCTGTTTCTCGAGAAACAGGATGTGTTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024819.3-420s1c1
Sequence:CCGGCTGGAGAATGGCGACATAAATCTCGAGATTTATGTCGCCATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-566s1c1
Sequence:CCGGCCGCTACGTGATTCTGGATATCTCGAGATATCCAGAATCACGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024819
VALIDATED
DCAKD MISSION shRNA shRNA Plasmid DNA
dephospho-CoA kinase domain containing
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024819.4-505s21c1
Sequence:GTACCGGTGCTGGAGAACGGCGACATAACTCGAGTTATGTCGCCGTTCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-713s21c1
Sequence:CCGGGAAGCACACCGTGGTAGTATACTCGAGTATACTACCACGGTGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1220s21c1
Sequence:CCGGCTTTGGAGTGTATCCTATTTGCTCGAGCAAATAGGATACACTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1404s21c1
Sequence:GTACCGGAGGGTTCACTGGGCTTGAATCCTCGAGGATTCAAGCCCAGTGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1491s21c1
Sequence:CCGGCAAGGGTTTCCATGTTCAAACCTCGAGGTTTGAACATGGAAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024819.3-419s1c1
Sequence:CCGGGCTGGAGAATGGCGACATAAACTCGAGTTTATGTCGCCATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-590s1c1
Sequence:CCGGCCTGCTGTTTGAGACCAAGAACTCGAGTTCTTGGTCTCAAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-997s1c1
Sequence:CCGGGCCAGGTAACACATCCTGTTTCTCGAGAAACAGGATGTGTTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024819.3-420s1c1
Sequence:CCGGCTGGAGAATGGCGACATAAATCTCGAGATTTATGTCGCCATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-566s1c1
Sequence:CCGGCCGCTACGTGATTCTGGATATCTCGAGATATCCAGAATCACGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024819
VALIDATED
DCAKD MISSION shRNA Lentiviral Transduction Particles
dephospho-CoA kinase domain containing
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024819.4-505s21c1
Sequence:GTACCGGTGCTGGAGAACGGCGACATAACTCGAGTTATGTCGCCGTTCTCCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-713s21c1
Sequence:CCGGGAAGCACACCGTGGTAGTATACTCGAGTATACTACCACGGTGTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1220s21c1
Sequence:CCGGCTTTGGAGTGTATCCTATTTGCTCGAGCAAATAGGATACACTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1404s21c1
Sequence:GTACCGGAGGGTTCACTGGGCTTGAATCCTCGAGGATTCAAGCCCAGTGAACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377648    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024819.4-1491s21c1
Sequence:CCGGCAAGGGTTTCCATGTTCAAACCTCGAGGTTTGAACATGGAAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024819.3-419s1c1
Sequence:CCGGGCTGGAGAATGGCGACATAAACTCGAGTTTATGTCGCCATTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-590s1c1
Sequence:CCGGCCTGCTGTTTGAGACCAAGAACTCGAGTTCTTGGTCTCAAACAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-997s1c1
Sequence:CCGGGCCAGGTAACACATCCTGTTTCTCGAGAAACAGGATGTGTTACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024819.3-420s1c1
Sequence:CCGGCTGGAGAATGGCGACATAAATCTCGAGATTTATGTCGCCATTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_024819.3-566s1c1
Sequence:CCGGCCGCTACGTGATTCTGGATATCTCGAGATATCCAGAATCACGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026551
VALIDATED
DCAKD MISSION shRNA Bacterial Glycerol Stock
dephospho-CoA kinase domain containing
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-708s21c1
Sequence:CCGGCCAATCACGTTCTGGACAACTCTCGAGAGTTGTCCAGAACGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-1258s21c1
Sequence:CCGGGTCTAGTGGACCACAGCAAATCTCGAGATTTGCTGTGGTCCACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-589s21c1
Sequence:CCGGAGTGTACTGTGACCGTGATACCTCGAGGTATCACGGTCACAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-514s21c1
Sequence:CCGGCCGATACGTGATTCTGGACATCTCGAGATGTCCAGAATCACGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026551.3-619s21c3
Sequence:CCGGGCGGCTGATGAAGCGGAACAACTCGAGTTGTTCCGCTTCATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-552s21c1
Sequence:CCGGCCAAGAAGCTGCTCAAGTATACTCGAGTATACTTGAGCAGCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-515s1c1
Sequence:CCGGCCGATACGTGATTCTGGACATCTCGAGATGTCCAGAATCACGTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-276s1c1
Sequence:CCGGGTAATCGACGTGGACGTCATTCTCGAGAATGACGTCCACGTCGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-709s1c1
Sequence:CCGGCCAATCACGTTCTGGACAACTCTCGAGAGTTGTCCAGAACGTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-620s1c1
Sequence:CCGGGCGGCTGATGAAGCGGAACAACTCGAGTTGTTCCGCTTCATCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026551.2-333s1c1
Sequence:CCGGCGGCGTATAGTAGAGGCCTTTCTCGAGAAAGGCCTCTACTATACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026551
VALIDATED
DCAKD MISSION shRNA shRNA Plasmid DNA
dephospho-CoA kinase domain containing
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-708s21c1
Sequence:CCGGCCAATCACGTTCTGGACAACTCTCGAGAGTTGTCCAGAACGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-1258s21c1
Sequence:CCGGGTCTAGTGGACCACAGCAAATCTCGAGATTTGCTGTGGTCCACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-589s21c1
Sequence:CCGGAGTGTACTGTGACCGTGATACCTCGAGGTATCACGGTCACAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-514s21c1
Sequence:CCGGCCGATACGTGATTCTGGACATCTCGAGATGTCCAGAATCACGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026551.3-619s21c3
Sequence:CCGGGCGGCTGATGAAGCGGAACAACTCGAGTTGTTCCGCTTCATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-552s21c1
Sequence:CCGGCCAAGAAGCTGCTCAAGTATACTCGAGTATACTTGAGCAGCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-515s1c1
Sequence:CCGGCCGATACGTGATTCTGGACATCTCGAGATGTCCAGAATCACGTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-276s1c1
Sequence:CCGGGTAATCGACGTGGACGTCATTCTCGAGAATGACGTCCACGTCGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-709s1c1
Sequence:CCGGCCAATCACGTTCTGGACAACTCTCGAGAGTTGTCCAGAACGTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-620s1c1
Sequence:CCGGGCGGCTGATGAAGCGGAACAACTCGAGTTGTTCCGCTTCATCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026551.2-333s1c1
Sequence:CCGGCGGCGTATAGTAGAGGCCTTTCTCGAGAAAGGCCTCTACTATACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026551
VALIDATED
DCAKD MISSION shRNA Lentiviral Transduction Particles
dephospho-CoA kinase domain containing
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-708s21c1
Sequence:CCGGCCAATCACGTTCTGGACAACTCTCGAGAGTTGTCCAGAACGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-1258s21c1
Sequence:CCGGGTCTAGTGGACCACAGCAAATCTCGAGATTTGCTGTGGTCCACTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-589s21c1
Sequence:CCGGAGTGTACTGTGACCGTGATACCTCGAGGTATCACGGTCACAGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-514s21c1
Sequence:CCGGCCGATACGTGATTCTGGACATCTCGAGATGTCCAGAATCACGTATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026551.3-619s21c3
Sequence:CCGGGCGGCTGATGAAGCGGAACAACTCGAGTTGTTCCGCTTCATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026551.3-552s21c1
Sequence:CCGGCCAAGAAGCTGCTCAAGTATACTCGAGTATACTTGAGCAGCTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-515s1c1
Sequence:CCGGCCGATACGTGATTCTGGACATCTCGAGATGTCCAGAATCACGTATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024818    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-276s1c1
Sequence:CCGGGTAATCGACGTGGACGTCATTCTCGAGAATGACGTCCACGTCGATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-709s1c1
Sequence:CCGGCCAATCACGTTCTGGACAACTCTCGAGAGTTGTCCAGAACGTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026551.2-620s1c1
Sequence:CCGGGCGGCTGATGAAGCGGAACAACTCGAGTTGTTCCGCTTCATCAGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026551.2-333s1c1
Sequence:CCGGCGGCGTATAGTAGAGGCCTTTCTCGAGAAAGGCCTCTACTATACGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks