EMAIL THIS PAGE TO A FRIEND

DCBLD1

discoidin, CUB and LCCL domain containing 1

151 Gene Product Result for
Synonyms: dJ94G16.1
UniProtKB ID: Q8N8Z6, Q5H992, Q8IYK5, Q8N7L9, Q96NH2
Gene ID:
Mouse(66686) discoidin, CUB and LCCL domain containing 1
Rat(309773) discoidin, CUB and LCCL domain containing 1
Zebrafish(664747) discoidin, CUB and LCCL domain containing 1
chicken(421734) discoidin, CUB and LCCL domain containing 1
cow(100298760) discoidin, CUB and LCCL domain containing 1
Horse(100072785) discoidin, CUB and LCCL domain containing 1
domestic cat(101096895) discoidin, CUB and LCCL domain containing 1
dog(484099) discoidin, CUB and LCCL domain containing 1
domestic guinea pig(100725351) discoidin, CUB and LCCL domain containing 1
naked mole-rat(101715159) discoidin, CUB and LCCL domain containing 1
sheep(101104072) discoidin, CUB and LCCL domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173674 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173674 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173674 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU040001 MISSION® esiRNA esiRNA targeting mouse Dcbld1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173674 Rosetta Predictions human pricing
XM_001058071 Rosetta Predictions rat pricing
XM_228172 Rosetta Predictions rat pricing
NM_025705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173674 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072630 predicted 706
2 SASI_Hs01_00072631 predicted 864
3 SASI_Hs01_00072632 predicted 684
4 SASI_Hs01_00072634 predicted 813
5 SASI_Hs01_00072636 predicted 482
6 SASI_Hs01_00072637 predicted 433
7 SASI_Hs01_00072638 predicted 1725
8 SASI_Hs02_00368604 predicted 848
9 SASI_Hs02_00368605 predicted 1341
10 SASI_Hs02_00368606 predicted 670
11 SASI_Hs01_00072633 predicted 584
12 SASI_Hs01_00072635 predicted 1548
13 SASI_Hs01_00072639 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058071 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288473 predicted 739
2 SASI_Rn02_00288474 predicted 1273
3 SASI_Rn02_00288475 predicted 852
4 SASI_Rn02_00288476 predicted 1048
5 SASI_Rn02_00288477 predicted 850
6 SASI_Rn02_00288478 predicted 1048
7 SASI_Rn02_00288479 predicted 424
8 SASI_Rn02_00288480 predicted 759
9 SASI_Rn02_00288481 predicted 1283
10 SASI_Rn02_00288482 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384976 predicted 2231
2 SASI_Rn02_00384977 predicted 420
3 SASI_Rn02_00384978 predicted 583
4 SASI_Rn02_00384979 predicted 2203
5 SASI_Rn02_00384980 predicted 560
6 SASI_Rn02_00384981 predicted 388
7 SASI_Rn02_00384982 predicted 642
8 SASI_Rn02_00384983 predicted 550
9 SASI_Rn02_00384984 predicted 654
10 SASI_Rn02_00384985 predicted 406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176660 predicted 409
2 SASI_Mm01_00176664 predicted 1046
3 SASI_Mm01_00176665 predicted 1132
4 SASI_Mm01_00176666 predicted 681
5 SASI_Mm02_00328873 predicted 257
6 SASI_Mm01_00176667 predicted 816
7 SASI_Mm02_00328874 predicted 1113
8 SASI_Mm02_00328875 predicted 678
9 SASI_Mm01_00176668 predicted 746
10 SASI_Mm01_00176669 predicted 859
11 SASI_Mm01_00176661 predicted 1105
12 SASI_Mm01_00176662 predicted 648
13 SASI_Mm01_00176663 predicted 1302
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025705
VALIDATED
DCBLD1 MISSION shRNA Bacterial Glycerol Stock
discoidin, CUB and LCCL domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-1751s1c1
Sequence:CCGGCCTCACTTACTGTTTACAGAACTCGAGTTCTGTAAACAGTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025705.1-1391s1c1
Sequence:CCGGCCACTCACAAACACTCCCATTCTCGAGAATGGGAGTGTTTGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-649s1c1
Sequence:CCGGGCAGGAGATATTTCTGGGAATCTCGAGATTCCCAGAAATATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-721s1c1
Sequence:CCGGGCAGGGATCATCACAGATGAACTCGAGTTCATCTGTGATGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025705.1-1046s1c1
Sequence:CCGGCGACGGAATTTACCATCAGCTCTCGAGAGCTGATGGTAAATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-419s21c1
Sequence:CCGGCAGATCAGTATGGTCCATATTCTCGAGAATATGGACCATACTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-1109s21c1
Sequence:CCGGCTAGTGATATGGCAGATTATCCTCGAGGATAATCTGCCATATCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-1751s21c1
Sequence:CCGGCCTCACTTACTGTTTACAGAACTCGAGTTCTGTAAACAGTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-649s21c1
Sequence:CCGGGCAGGAGATATTTCTGGGAATCTCGAGATTCCCAGAAATATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025705.3-1391s21c1
Sequence:CCGGCCACTCACAAACACTCCCATTCTCGAGAATGGGAGTGTTTGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025705
VALIDATED
DCBLD1 MISSION shRNA shRNA Plasmid DNA
discoidin, CUB and LCCL domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-1751s1c1
Sequence:CCGGCCTCACTTACTGTTTACAGAACTCGAGTTCTGTAAACAGTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025705.1-1391s1c1
Sequence:CCGGCCACTCACAAACACTCCCATTCTCGAGAATGGGAGTGTTTGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-649s1c1
Sequence:CCGGGCAGGAGATATTTCTGGGAATCTCGAGATTCCCAGAAATATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-721s1c1
Sequence:CCGGGCAGGGATCATCACAGATGAACTCGAGTTCATCTGTGATGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025705.1-1046s1c1
Sequence:CCGGCGACGGAATTTACCATCAGCTCTCGAGAGCTGATGGTAAATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-419s21c1
Sequence:CCGGCAGATCAGTATGGTCCATATTCTCGAGAATATGGACCATACTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-1109s21c1
Sequence:CCGGCTAGTGATATGGCAGATTATCCTCGAGGATAATCTGCCATATCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-1751s21c1
Sequence:CCGGCCTCACTTACTGTTTACAGAACTCGAGTTCTGTAAACAGTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-649s21c1
Sequence:CCGGGCAGGAGATATTTCTGGGAATCTCGAGATTCCCAGAAATATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025705.3-1391s21c1
Sequence:CCGGCCACTCACAAACACTCCCATTCTCGAGAATGGGAGTGTTTGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025705
VALIDATED
DCBLD1 MISSION shRNA Lentiviral Transduction Particles
discoidin, CUB and LCCL domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098320    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-1751s1c1
Sequence:CCGGCCTCACTTACTGTTTACAGAACTCGAGTTCTGTAAACAGTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025705.1-1391s1c1
Sequence:CCGGCCACTCACAAACACTCCCATTCTCGAGAATGGGAGTGTTTGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-649s1c1
Sequence:CCGGGCAGGAGATATTTCTGGGAATCTCGAGATTCCCAGAAATATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025705.1-721s1c1
Sequence:CCGGGCAGGGATCATCACAGATGAACTCGAGTTCATCTGTGATGATCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025705.1-1046s1c1
Sequence:CCGGCGACGGAATTTACCATCAGCTCTCGAGAGCTGATGGTAAATTCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-419s21c1
Sequence:CCGGCAGATCAGTATGGTCCATATTCTCGAGAATATGGACCATACTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-1109s21c1
Sequence:CCGGCTAGTGATATGGCAGATTATCCTCGAGGATAATCTGCCATATCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-1751s21c1
Sequence:CCGGCCTCACTTACTGTTTACAGAACTCGAGTTCTGTAAACAGTAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025705.3-649s21c1
Sequence:CCGGGCAGGAGATATTTCTGGGAATCTCGAGATTCCCAGAAATATCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025705.3-1391s21c1
Sequence:CCGGCCACTCACAAACACTCCCATTCTCGAGAATGGGAGTGTTTGTGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173674
VALIDATED
DCBLD1 MISSION shRNA Bacterial Glycerol Stock
discoidin, CUB and LCCL domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173674.1-1465s1c1
Sequence:CCGGCGGAAGAAACATCCACAGGAACTCGAGTTCCTGTGGATGTTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173674.1-313s1c1
Sequence:CCGGCCAATCACACTGTTTGCGAAACTCGAGTTTCGCAAACAGTGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173674.1-741s1c1
Sequence:CCGGGCAGGAATAATTGCTGATGAACTCGAGTTCATCAGCAATTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173674.1-1841s1c1
Sequence:CCGGCCATGTTCTTTCCCACCCTAACTCGAGTTAGGGTGGGAAAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173674.1-1665s1c1
Sequence:CCGGGCTGAGTTTACCATCAGCTATCTCGAGATAGCTGATGGTAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-601s21c1
Sequence:CCGGTGGAACGAGCTAGCCATTATTCTCGAGAATAATGGCTAGCTCGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-572s21c1
Sequence:CCGGCAGCGACCATCCAGATTTAATCTCGAGATTAAATCTGGATGGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-1182s21c1
Sequence:CCGGTCTAAGTGGAAGACCTATAAACTCGAGTTTATAGGTCTTCCACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-1620s21c1
Sequence:CCGGGACTGTTGGAAGCAGATTAAACTCGAGTTTAATCTGCTTCCAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-686s21c1
Sequence:CCGGGAATATGGTAGATGGATATAGCTCGAGCTATATCCATCTACCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173674
VALIDATED
DCBLD1 MISSION shRNA shRNA Plasmid DNA
discoidin, CUB and LCCL domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173674.1-1465s1c1
Sequence:CCGGCGGAAGAAACATCCACAGGAACTCGAGTTCCTGTGGATGTTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173674.1-313s1c1
Sequence:CCGGCCAATCACACTGTTTGCGAAACTCGAGTTTCGCAAACAGTGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173674.1-741s1c1
Sequence:CCGGGCAGGAATAATTGCTGATGAACTCGAGTTCATCAGCAATTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173674.1-1841s1c1
Sequence:CCGGCCATGTTCTTTCCCACCCTAACTCGAGTTAGGGTGGGAAAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173674.1-1665s1c1
Sequence:CCGGGCTGAGTTTACCATCAGCTATCTCGAGATAGCTGATGGTAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-601s21c1
Sequence:CCGGTGGAACGAGCTAGCCATTATTCTCGAGAATAATGGCTAGCTCGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-572s21c1
Sequence:CCGGCAGCGACCATCCAGATTTAATCTCGAGATTAAATCTGGATGGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-1182s21c1
Sequence:CCGGTCTAAGTGGAAGACCTATAAACTCGAGTTTATAGGTCTTCCACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-1620s21c1
Sequence:CCGGGACTGTTGGAAGCAGATTAAACTCGAGTTTAATCTGCTTCCAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-686s21c1
Sequence:CCGGGAATATGGTAGATGGATATAGCTCGAGCTATATCCATCTACCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173674
VALIDATED
DCBLD1 MISSION shRNA Lentiviral Transduction Particles
discoidin, CUB and LCCL domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173674.1-1465s1c1
Sequence:CCGGCGGAAGAAACATCCACAGGAACTCGAGTTCCTGTGGATGTTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_173674.1-313s1c1
Sequence:CCGGCCAATCACACTGTTTGCGAAACTCGAGTTTCGCAAACAGTGTGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173674.1-741s1c1
Sequence:CCGGGCAGGAATAATTGCTGATGAACTCGAGTTCATCAGCAATTATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107020    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173674.1-1841s1c1
Sequence:CCGGCCATGTTCTTTCCCACCCTAACTCGAGTTAGGGTGGGAAAGAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173674.1-1665s1c1
Sequence:CCGGGCTGAGTTTACCATCAGCTATCTCGAGATAGCTGATGGTAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-601s21c1
Sequence:CCGGTGGAACGAGCTAGCCATTATTCTCGAGAATAATGGCTAGCTCGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-572s21c1
Sequence:CCGGCAGCGACCATCCAGATTTAATCTCGAGATTAAATCTGGATGGTCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-1182s21c1
Sequence:CCGGTCTAAGTGGAAGACCTATAAACTCGAGTTTATAGGTCTTCCACTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-1620s21c1
Sequence:CCGGGACTGTTGGAAGCAGATTAAACTCGAGTTTAATCTGCTTCCAACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173674.1-686s21c1
Sequence:CCGGGAATATGGTAGATGGATATAGCTCGAGCTATATCCATCTACCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks