EMAIL THIS PAGE TO A FRIEND

DCBLD2

discoidin, CUB and LCCL domain containing 2

222 Gene Product Result for
Synonyms: CLCP1 ESDN
UniProtKB ID: Q96PD2, B7WNL1, D3DN41, Q8N6M4, Q8TDX2
Gene ID:
Mouse(73379) discoidin, CUB and LCCL domain containing 2
Rat(155696) discoidin, CUB and LCCL domain containing 2
sheep(101107057) discoidin, CUB and LCCL domain containing 2
Domestic Rabbit(100354803) discoidin, CUB and LCCL domain containing 2
naked mole-rat(101704399) discoidin, CUB and LCCL domain containing 2
domestic guinea pig(100712739) discoidin, CUB and LCCL domain containing 2
Zebrafish(557649) discoidin, CUB and LCCL domain containing 2
chicken(418379) discoidin, CUB and LCCL domain containing 2
dog(487949) discoidin, CUB and LCCL domain containing 2
Horse(100072384) discoidin, CUB and LCCL domain containing 2
cow(524608) discoidin, CUB and LCCL domain containing 2
domestic cat(101097580) discoidin, CUB and LCCL domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080927 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080927 Rosetta Predictions human pricing
NM_130419 Rosetta Predictions rat pricing
XM_579611 Rosetta Predictions rat pricing
NM_028523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038663 predicted 903
2 SASI_Hs01_00038664 predicted 1985
3 SASI_Hs01_00038667 predicted 1627
4 SASI_Hs02_00362691 predicted 862
5 SASI_Hs01_00038668 predicted 1119
6 SASI_Hs01_00038669 predicted 1399
7 SASI_Hs01_00038670 predicted 2240
8 SASI_Hs01_00038671 predicted 2312
9 SASI_Hs02_00362692 predicted 818
10 SASI_Hs01_00038672 predicted 2496
11 SASI_Hs01_00038665 predicted 1269
12 SASI_Hs01_00038666 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267416 predicted 1228
2 SASI_Rn01_00117788 predicted 572
3 SASI_Rn01_00117790 predicted 1110
4 SASI_Rn01_00117791 predicted 1237
5 SASI_Rn01_00117792 predicted 749
6 SASI_Rn01_00117793 predicted 1263
7 SASI_Rn02_00267417 predicted 669
8 SASI_Rn01_00117794 predicted 806
9 SASI_Rn01_00117796 predicted 1875
10 SASI_Rn02_00267418 predicted 331
11 SASI_Rn01_00117787 predicted 369
12 SASI_Rn01_00117789 predicted 857
13 SASI_Rn01_00117795 predicted 1902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579611 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126014 predicted 536
2 SASI_Rn01_00126015 predicted 652
3 SASI_Rn01_00126016 predicted 904
4 SASI_Rn01_00126017 predicted 555
5 SASI_Rn01_00126018 predicted 344
6 SASI_Rn01_00126019 predicted 464
7 SASI_Rn01_00126020 predicted 906
8 SASI_Rn01_00126021 predicted 605
9 SASI_Rn01_00126022 predicted 850
10 SASI_Rn01_00126023 predicted 291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131242 predicted 573
2 SASI_Mm01_00131243 predicted 787
3 SASI_Mm01_00131244 predicted 958
4 SASI_Mm01_00131245 predicted 873
5 SASI_Mm02_00333990 predicted 2592
6 SASI_Mm01_00131246 predicted 1284
7 SASI_Mm01_00131247 predicted 1471
8 SASI_Mm01_00131248 predicted 1723
9 SASI_Mm01_00131249 predicted 2546
10 SASI_Mm01_00131250 predicted 472
11 SASI_Mm01_00131251 predicted 954
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028523
DCBLD2 MISSION shRNA Bacterial Glycerol Stock
discoidin, CUB and LCCL domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-1479s21c1
Sequence:CCGGCCAATTATTGCACGTTTCATTCTCGAGAATGAAACGTGCAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-2105s21c1
Sequence:CCGGCCATCAGAGATCCACCTTTAACTCGAGTTAAAGGTGGATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-632s21c1
Sequence:CCGGCAGAACGGAAATAGGCAAATACTCGAGTATTTGCCTATTTCCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-998s21c1
Sequence:CCGGCCCATATTATGAAAGCTCTTTCTCGAGAAAGAGCTTTCATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1090s1c1
Sequence:CCGGCCCATATTATGAAAGCTCTTTCTCGAGAAAGAGCTTTCATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-724s1c1
Sequence:CCGGCAGAACGGAAATAGGCAAATACTCGAGTATTTGCCTATTTCCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1645s1c1
Sequence:CCGGCGGATGTCAGTTTACTCTCAACTCGAGTTGAGAGTAAACTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-2197s1c1
Sequence:CCGGCCATCAGAGATCCACCTTTAACTCGAGTTAAAGGTGGATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1571s1c1
Sequence:CCGGCCAATTATTGCACGTTTCATTCTCGAGAATGAAACGTGCAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028523
DCBLD2 MISSION shRNA shRNA Plasmid DNA
discoidin, CUB and LCCL domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-1479s21c1
Sequence:CCGGCCAATTATTGCACGTTTCATTCTCGAGAATGAAACGTGCAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-2105s21c1
Sequence:CCGGCCATCAGAGATCCACCTTTAACTCGAGTTAAAGGTGGATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-632s21c1
Sequence:CCGGCAGAACGGAAATAGGCAAATACTCGAGTATTTGCCTATTTCCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-998s21c1
Sequence:CCGGCCCATATTATGAAAGCTCTTTCTCGAGAAAGAGCTTTCATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1090s1c1
Sequence:CCGGCCCATATTATGAAAGCTCTTTCTCGAGAAAGAGCTTTCATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-724s1c1
Sequence:CCGGCAGAACGGAAATAGGCAAATACTCGAGTATTTGCCTATTTCCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1645s1c1
Sequence:CCGGCGGATGTCAGTTTACTCTCAACTCGAGTTGAGAGTAAACTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-2197s1c1
Sequence:CCGGCCATCAGAGATCCACCTTTAACTCGAGTTAAAGGTGGATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1571s1c1
Sequence:CCGGCCAATTATTGCACGTTTCATTCTCGAGAATGAAACGTGCAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028523
DCBLD2 MISSION shRNA Lentiviral Transduction Particles
discoidin, CUB and LCCL domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-1479s21c1
Sequence:CCGGCCAATTATTGCACGTTTCATTCTCGAGAATGAAACGTGCAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-2105s21c1
Sequence:CCGGCCATCAGAGATCCACCTTTAACTCGAGTTAAAGGTGGATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-632s21c1
Sequence:CCGGCAGAACGGAAATAGGCAAATACTCGAGTATTTGCCTATTTCCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028523.3-998s21c1
Sequence:CCGGCCCATATTATGAAAGCTCTTTCTCGAGAAAGAGCTTTCATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1090s1c1
Sequence:CCGGCCCATATTATGAAAGCTCTTTCTCGAGAAAGAGCTTTCATAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-724s1c1
Sequence:CCGGCAGAACGGAAATAGGCAAATACTCGAGTATTTGCCTATTTCCGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1645s1c1
Sequence:CCGGCGGATGTCAGTTTACTCTCAACTCGAGTTGAGAGTAAACTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-2197s1c1
Sequence:CCGGCCATCAGAGATCCACCTTTAACTCGAGTTAAAGGTGGATCTCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028523.2-1571s1c1
Sequence:CCGGCCAATTATTGCACGTTTCATTCTCGAGAATGAAACGTGCAATAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080927
VALIDATED
DCBLD2 MISSION shRNA Bacterial Glycerol Stock
discoidin, CUB and LCCL domain containing 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-4325s1c1
Sequence:CCGGCGCTTCAGAAAGAGAACTGTTCTCGAGAACAGTTCTCTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080927.3-1626s1c1
Sequence:CCGGGCCACCAATTATTGCACGTTTCTCGAGAAACGTGCAATAATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-1116s1c1
Sequence:CCGGCGGCCAAATCAGTGTTGTAATCTCGAGATTACAACACTGATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080927.3-1704s1c1
Sequence:CCGGCGGATGTCAGTTTATTCCTAACTCGAGTTAGGAATAAACTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-1559s1c1
Sequence:CCGGGTGTGGAGCAAGATAAGATATCTCGAGATATCTTATCTTGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080927
VALIDATED
DCBLD2 MISSION shRNA shRNA Plasmid DNA
discoidin, CUB and LCCL domain containing 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-4325s1c1
Sequence:CCGGCGCTTCAGAAAGAGAACTGTTCTCGAGAACAGTTCTCTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080927.3-1626s1c1
Sequence:CCGGGCCACCAATTATTGCACGTTTCTCGAGAAACGTGCAATAATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-1116s1c1
Sequence:CCGGCGGCCAAATCAGTGTTGTAATCTCGAGATTACAACACTGATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080927.3-1704s1c1
Sequence:CCGGCGGATGTCAGTTTATTCCTAACTCGAGTTAGGAATAAACTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-1559s1c1
Sequence:CCGGGTGTGGAGCAAGATAAGATATCTCGAGATATCTTATCTTGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080927
VALIDATED
DCBLD2 MISSION shRNA Lentiviral Transduction Particles
discoidin, CUB and LCCL domain containing 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-4325s1c1
Sequence:CCGGCGCTTCAGAAAGAGAACTGTTCTCGAGAACAGTTCTCTTTCTGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080927.3-1626s1c1
Sequence:CCGGGCCACCAATTATTGCACGTTTCTCGAGAAACGTGCAATAATTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-1116s1c1
Sequence:CCGGCGGCCAAATCAGTGTTGTAATCTCGAGATTACAACACTGATTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080927.3-1704s1c1
Sequence:CCGGCGGATGTCAGTTTATTCCTAACTCGAGTTAGGAATAAACTGACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_080927.3-1559s1c1
Sequence:CCGGGTGTGGAGCAAGATAAGATATCTCGAGATATCTTATCTTGCTCCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks