EMAIL THIS PAGE TO A FRIEND

DCC

deleted in colorectal carcinoma

125 Gene Product Result for
Synonyms: CRC18 CRCR1 IGDCC1 MRMV1
UniProtKB ID: P43146
Gene ID:
Human(1630) Summary: This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
Mouse(13176) deleted in colorectal carcinoma
Rat(25311) deleted in colorectal carcinoma
Zebrafish(569360) deleted in colorectal carcinoma
dog(483976) deleted in colorectal carcinoma
cow(537176) deleted in colorectal carcinoma
Horse(100054013) deleted in colorectal carcinoma
domestic cat(101098832) deleted in colorectal carcinoma
domestic guinea pig(100712666) deleted in colorectal carcinoma
naked mole-rat(101705571) deleted in colorectal carcinoma
sheep(101118654) deleted in colorectal carcinoma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005215 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014471 MISSION® esiRNA esiRNA targeting human DCC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005215 Rosetta Predictions human pricing
NM_012841 Rosetta Predictions rat pricing
NM_007831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339193 predicted 1395
2 SASI_Hs02_00339194 predicted 4825
3 SASI_Hs01_00030540 predicted 3556
4 SASI_Hs01_00030541 predicted 3641
5 SASI_Hs01_00030542 predicted 2949
6 SASI_Hs02_00339195 predicted 3682
7 SASI_Hs01_00030544 predicted 3761
8 SASI_Hs02_00339196 predicted 4874
9 SASI_Hs02_00339197 predicted 1566
10 SASI_Hs01_00030545 predicted 1321
11 SASI_Hs01_00030539 predicted 1169
12 SASI_Hs01_00030543 predicted 3034
13 SASI_Hs01_00030546 predicted 618
14 SASI_Hs01_00030547 predicted 3218
15 SASI_Hs01_00030548 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012841 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052238 predicted 3374
2 SASI_Rn01_00052239 predicted 1245
3 SASI_Rn01_00052240 predicted 2691
4 SASI_Rn01_00052241 predicted 601
5 SASI_Rn01_00052242 predicted 3062
6 SASI_Rn01_00052243 predicted 4667
7 SASI_Rn01_00052244 predicted 1981
8 SASI_Rn01_00052245 predicted 3509
9 SASI_Rn01_00052246 predicted 3608
10 SASI_Rn01_00052247 predicted 2045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312567 predicted 4904
2 SASI_Mm01_00035433 predicted 2986
3 SASI_Mm01_00035434 predicted 3352
4 SASI_Mm01_00035435 predicted 1323
5 SASI_Mm01_00035436 predicted 2440
6 SASI_Mm01_00035437 predicted 843
7 SASI_Mm01_00035439 predicted 890
8 SASI_Mm02_00312568 predicted 5000
9 SASI_Mm01_00035440 predicted 3662
10 SASI_Mm01_00035442 predicted 2336
11 SASI_Mm01_00035438 predicted 3140
12 SASI_Mm01_00035441 predicted 2191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007831
DCC MISSION shRNA Bacterial Glycerol Stock
deleted in colorectal carcinoma
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-3015s1c1
Sequence:CCGGCCCAAGGATCTGACAGTCATTCTCGAGAATGACTGTCAGATCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-825s1c1
Sequence:CCGGGCCAGCATAAGAACAGGAAATCTCGAGATTTCCTGTTCTTATGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-678s1c1
Sequence:CCGGCCAACAATACACTGGCAGAAACTCGAGTTTCTGCCAGTGTATTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-3362s1c1
Sequence:CCGGGCCAGTTGATACTAACTTGATCTCGAGATCAAGTTAGTATCAACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-2565s1c1
Sequence:CCGGGCTTTCAACAATGCCGGAGAACTCGAGTTCTCCGGCATTGTTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007831
DCC MISSION shRNA shRNA Plasmid DNA
deleted in colorectal carcinoma
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-3015s1c1
Sequence:CCGGCCCAAGGATCTGACAGTCATTCTCGAGAATGACTGTCAGATCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-825s1c1
Sequence:CCGGGCCAGCATAAGAACAGGAAATCTCGAGATTTCCTGTTCTTATGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-678s1c1
Sequence:CCGGCCAACAATACACTGGCAGAAACTCGAGTTTCTGCCAGTGTATTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-3362s1c1
Sequence:CCGGGCCAGTTGATACTAACTTGATCTCGAGATCAAGTTAGTATCAACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-2565s1c1
Sequence:CCGGGCTTTCAACAATGCCGGAGAACTCGAGTTCTCCGGCATTGTTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007831
DCC MISSION shRNA Lentiviral Transduction Particles
deleted in colorectal carcinoma
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-3015s1c1
Sequence:CCGGCCCAAGGATCTGACAGTCATTCTCGAGAATGACTGTCAGATCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-825s1c1
Sequence:CCGGGCCAGCATAAGAACAGGAAATCTCGAGATTTCCTGTTCTTATGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-678s1c1
Sequence:CCGGCCAACAATACACTGGCAGAAACTCGAGTTTCTGCCAGTGTATTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-3362s1c1
Sequence:CCGGGCCAGTTGATACTAACTTGATCTCGAGATCAAGTTAGTATCAACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007831.1-2565s1c1
Sequence:CCGGGCTTTCAACAATGCCGGAGAACTCGAGTTCTCCGGCATTGTTGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005215
DCC MISSION shRNA Bacterial Glycerol Stock
deleted in colorectal carcinoma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-2265s1c1
Sequence:CCGGGCGAGGTTATATTATCGGTTACTCGAGTAACCGATAATATAACCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-736s1c1
Sequence:CCGGCCATCCAATGTAGTAGCCATTCTCGAGAATGGCTACTACATTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005215.1-4387s1c1
Sequence:CCGGGCAGCATACCAATTACCCATACTCGAGTATGGGTAATTGGTATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-1820s1c1
Sequence:CCGGGCGTCTCTACTGATGATATAACTCGAGTTATATCATCAGTAGAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-2466s1c1
Sequence:CCGGCCCAGTTGATTATTATCCTTTCTCGAGAAAGGATAATAATCAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.x-473s1c1
Sequence:CCGGTACTCAAGTGTGAAGTCATTGCTCGAGCAATGACTTCACACTTGAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.x-3944s1c1
Sequence:CCGGCATCTCAGCCTGAGCATTCTACTCGAGTAGAATGCTCAGGCTGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005215.x-4488s1c1
Sequence:CCGGCAGTTCAGAAGGAATAAGCATCTCGAGATGCTTATTCCTTCTGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005215
DCC MISSION shRNA shRNA Plasmid DNA
deleted in colorectal carcinoma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-2265s1c1
Sequence:CCGGGCGAGGTTATATTATCGGTTACTCGAGTAACCGATAATATAACCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-736s1c1
Sequence:CCGGCCATCCAATGTAGTAGCCATTCTCGAGAATGGCTACTACATTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005215.1-4387s1c1
Sequence:CCGGGCAGCATACCAATTACCCATACTCGAGTATGGGTAATTGGTATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-1820s1c1
Sequence:CCGGGCGTCTCTACTGATGATATAACTCGAGTTATATCATCAGTAGAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-2466s1c1
Sequence:CCGGCCCAGTTGATTATTATCCTTTCTCGAGAAAGGATAATAATCAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.x-473s1c1
Sequence:CCGGTACTCAAGTGTGAAGTCATTGCTCGAGCAATGACTTCACACTTGAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.x-3944s1c1
Sequence:CCGGCATCTCAGCCTGAGCATTCTACTCGAGTAGAATGCTCAGGCTGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005215.x-4488s1c1
Sequence:CCGGCAGTTCAGAAGGAATAAGCATCTCGAGATGCTTATTCCTTCTGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005215
DCC MISSION shRNA Lentiviral Transduction Particles
deleted in colorectal carcinoma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-2265s1c1
Sequence:CCGGGCGAGGTTATATTATCGGTTACTCGAGTAACCGATAATATAACCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-736s1c1
Sequence:CCGGCCATCCAATGTAGTAGCCATTCTCGAGAATGGCTACTACATTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005215.1-4387s1c1
Sequence:CCGGGCAGCATACCAATTACCCATACTCGAGTATGGGTAATTGGTATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-1820s1c1
Sequence:CCGGGCGTCTCTACTGATGATATAACTCGAGTTATATCATCAGTAGAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.1-2466s1c1
Sequence:CCGGCCCAGTTGATTATTATCCTTTCTCGAGAAAGGATAATAATCAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.x-473s1c1
Sequence:CCGGTACTCAAGTGTGAAGTCATTGCTCGAGCAATGACTTCACACTTGAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005215.x-3944s1c1
Sequence:CCGGCATCTCAGCCTGAGCATTCTACTCGAGTAGAATGCTCAGGCTGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005215.x-4488s1c1
Sequence:CCGGCAGTTCAGAAGGAATAAGCATCTCGAGATGCTTATTCCTTCTGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)