EMAIL THIS PAGE TO A FRIEND

DCD

dermcidin

Synonyms: AIDD DCD-1 DSEP HCAP PIF
Species: Human DCD(117159)
UniProtKB ID: P81605, A5JHP2, A5JHP3, P58461, Q53YJ2
Gene ID:
Human(117159) Summary: This gene encodes a secreted protein that is subsequently processed into mature peptides of distinct biological activities. The C-terminal peptide is constitutively expressed in sweat and has antibacterial and antifungal activities. The N-terminal peptide, also known as diffusible survival evasion peptide, promotes neural cell survival under conditions of severe oxidative stress. A glycosylated form of the N-terminal peptide may be associated with cachexia (muscle wasting) in cancer patients. [provided by RefSeq, Jul 2008]
16 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053283 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053283 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164994 predicted 209
2 SASI_Hs01_00164995 predicted 230
3 SASI_Hs01_00164996 predicted 211
4 SASI_Hs01_00164997 predicted 215
5 SASI_Hs01_00164998 predicted 371
6 SASI_Hs01_00164999 predicted 63
7 SASI_Hs01_00165000 predicted 325
8 SASI_Hs01_00165001 predicted 367
9 SASI_Hs01_00165002 predicted 371
10 SASI_Hs01_00165003 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053283
DCD MISSION shRNA Bacterial Glycerol Stock
dermcidin
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-109s21c1
Sequence:CCGGTGGTCTGTGCCTATGATCCAGCTCGAGCTGGATCATAGGCACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-155s21c1
Sequence:CCGGGAACCCTTGCCATGAAGCATCCTCGAGGATGCTTCATGGCAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-213s21c1
Sequence:CCGGTTAGCCAGACAGGCACCAAAGCTCGAGCTTTGGTGCCTGTCTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-239s21c1
Sequence:CCGGGAAGCAGAGATCCAGCCTTCTCTCGAGAGAAGGCTGGATCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-330s21c1
Sequence:CCGGGATCTAGAAAGCGTGGGTAAACTCGAGTTTACCCACGCTTTCTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053283
DCD MISSION shRNA shRNA Plasmid DNA
dermcidin
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-109s21c1
Sequence:CCGGTGGTCTGTGCCTATGATCCAGCTCGAGCTGGATCATAGGCACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-155s21c1
Sequence:CCGGGAACCCTTGCCATGAAGCATCCTCGAGGATGCTTCATGGCAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-213s21c1
Sequence:CCGGTTAGCCAGACAGGCACCAAAGCTCGAGCTTTGGTGCCTGTCTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-239s21c1
Sequence:CCGGGAAGCAGAGATCCAGCCTTCTCTCGAGAGAAGGCTGGATCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-330s21c1
Sequence:CCGGGATCTAGAAAGCGTGGGTAAACTCGAGTTTACCCACGCTTTCTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053283
DCD MISSION shRNA Lentiviral Transduction Particles
dermcidin
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-109s21c1
Sequence:CCGGTGGTCTGTGCCTATGATCCAGCTCGAGCTGGATCATAGGCACAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-155s21c1
Sequence:CCGGGAACCCTTGCCATGAAGCATCCTCGAGGATGCTTCATGGCAAGGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-213s21c1
Sequence:CCGGTTAGCCAGACAGGCACCAAAGCTCGAGCTTTGGTGCCTGTCTGGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-239s21c1
Sequence:CCGGGAAGCAGAGATCCAGCCTTCTCTCGAGAGAAGGCTGGATCTCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053283.2-330s21c1
Sequence:CCGGGATCTAGAAAGCGTGGGTAAACTCGAGTTTACCCACGCTTTCTAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks