EMAIL THIS PAGE TO A FRIEND

DCDC1

doublecortin domain containing 1

43 Gene Product Result for
UniProtKB ID: P59894, A6PVL6
Gene ID:
Human(341019) Summary: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a hydrophilic, intracellular protein. It contains a single doublecortin domain and is unable to bind microtubules and to regulate microtubule polymerization. This gene is mainly expressed in adult testis. It does not have a mouse homolog. [provided by RefSeq, Sep 2010]
chicken(101669103) doublecortin domain containing 1
cow(616832) doublecortin domain containing 1
domestic cat(101090209) doublecortin domain containing 1
dog(483443) doublecortin domain containing 1
sheep(101112087) doublecortin domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181807 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104391 MISSION® esiRNA esiRNA human DCDC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181807 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191527 predicted 533
2 SASI_Hs01_00191528 predicted 981
3 SASI_Hs02_00370410 predicted 1121
4 SASI_Hs02_00370411 predicted 956
5 SASI_Hs01_00191531 predicted 447
6 SASI_Hs02_00370412 predicted 683
7 SASI_Hs02_00370413 predicted 907
8 SASI_Hs01_00191533 predicted 1331
9 SASI_Hs01_00191534 predicted 1299
10 SASI_Hs01_00191535 predicted 624
11 SASI_Hs01_00191526 predicted 994
12 SASI_Hs01_00191529 predicted 551
13 SASI_Hs01_00191530 predicted 566
14 SASI_Hs01_00191532 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181807
DCDC1 MISSION shRNA Bacterial Glycerol Stock
doublecortin domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-370s1c1
Sequence:CCGGGTTTATGTCATCCCAGGCAAACTCGAGTTTGCCTGGGATGACATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-753s1c1
Sequence:CCGGGAACAGTCTTTGCCAGAGTTACTCGAGTAACTCTGGCAAAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-638s1c1
Sequence:CCGGGTTGCAGAGTTCTCTTCTTTACTCGAGTAAAGAAGAGAACTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181807.1-1513s1c1
Sequence:CCGGGCACCCTAGTCACTTAACATTCTCGAGAATGTTAAGTGACTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-1126s1c1
Sequence:CCGGGCATGAGATTACAGTGGGAAACTCGAGTTTCCCACTGTAATCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181807.1-1272s1c1
Sequence:CCGGGAGACGTGATACTTCATGGATCTCGAGATCCATGAAGTATCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-236s1c1
Sequence:CCGGGCACTATCTCAGTCTTCCTTACTCGAGTAAGGAAGACTGAGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181807.1-1445s1c1
Sequence:CCGGCATTACAAGTTCACTGGACTTCTCGAGAAGTCCAGTGAACTTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-1000s1c1
Sequence:CCGGGTTGATGCTTCCTACTGATATCTCGAGATATCAGTAGGAAGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181807
DCDC1 MISSION shRNA shRNA Plasmid DNA
doublecortin domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-370s1c1
Sequence:CCGGGTTTATGTCATCCCAGGCAAACTCGAGTTTGCCTGGGATGACATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-753s1c1
Sequence:CCGGGAACAGTCTTTGCCAGAGTTACTCGAGTAACTCTGGCAAAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-638s1c1
Sequence:CCGGGTTGCAGAGTTCTCTTCTTTACTCGAGTAAAGAAGAGAACTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181807.1-1513s1c1
Sequence:CCGGGCACCCTAGTCACTTAACATTCTCGAGAATGTTAAGTGACTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-1126s1c1
Sequence:CCGGGCATGAGATTACAGTGGGAAACTCGAGTTTCCCACTGTAATCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181807.1-1272s1c1
Sequence:CCGGGAGACGTGATACTTCATGGATCTCGAGATCCATGAAGTATCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-236s1c1
Sequence:CCGGGCACTATCTCAGTCTTCCTTACTCGAGTAAGGAAGACTGAGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181807.1-1445s1c1
Sequence:CCGGCATTACAAGTTCACTGGACTTCTCGAGAAGTCCAGTGAACTTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-1000s1c1
Sequence:CCGGGTTGATGCTTCCTACTGATATCTCGAGATATCAGTAGGAAGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181807
DCDC1 MISSION shRNA Lentiviral Transduction Particles
doublecortin domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-370s1c1
Sequence:CCGGGTTTATGTCATCCCAGGCAAACTCGAGTTTGCCTGGGATGACATAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-753s1c1
Sequence:CCGGGAACAGTCTTTGCCAGAGTTACTCGAGTAACTCTGGCAAAGACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-638s1c1
Sequence:CCGGGTTGCAGAGTTCTCTTCTTTACTCGAGTAAAGAAGAGAACTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149072    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181807.1-1513s1c1
Sequence:CCGGGCACCCTAGTCACTTAACATTCTCGAGAATGTTAAGTGACTAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181807.1-1126s1c1
Sequence:CCGGGCATGAGATTACAGTGGGAAACTCGAGTTTCCCACTGTAATCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130562    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181807.1-1272s1c1
Sequence:CCGGGAGACGTGATACTTCATGGATCTCGAGATCCATGAAGTATCACGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-236s1c1
Sequence:CCGGGCACTATCTCAGTCTTCCTTACTCGAGTAAGGAAGACTGAGATAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129708    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181807.1-1445s1c1
Sequence:CCGGCATTACAAGTTCACTGGACTTCTCGAGAAGTCCAGTGAACTTGTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181807.1-1000s1c1
Sequence:CCGGGTTGATGCTTCCTACTGATATCTCGAGATATCAGTAGGAAGCATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks