EMAIL THIS PAGE TO A FRIEND

DCDC2

doublecortin domain containing 2

171 Gene Product Result for
Synonyms: DCDC2A RU2 RU2S
Gene ID:
Human(51473) Summary: This gene encodes a doublecortin domain-containing family member. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. This family member is thought to function in neuronal migration where it may affect the signaling of primary cilia. Mutations in this gene have been associated with reading disability (RD) type 2, also referred to as developmental dyslexia. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jan 2013]
Rat(291130) doublecortin domain containing 2
sheep(101108088) doublecortin domain containing 2
Domestic Rabbit(100352162) doublecortin domain containing 2
naked mole-rat(101725649) doublecortin domain containing 2
domestic guinea pig(100723535) doublecortin domain containing 2
chicken(420821) doublecortin domain containing 2
domestic cat(101098053) doublecortin domain containing 2
cow(100297854) doublecortin domain containing 2
Horse(100052480) doublecortin domain containing 2
dog(488244) doublecortin domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016356 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046881 MISSION® esiRNA esiRNA human DCDC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016356 Rosetta Predictions human pricing
NM_001106110 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228786 predicted 1741
2 SASI_Hs01_00228787 predicted 589
3 SASI_Hs02_00349322 predicted 1059
4 SASI_Hs01_00228788 predicted 851
5 SASI_Hs02_00349323 predicted 1045
6 SASI_Hs02_00349324 predicted 858
7 SASI_Hs02_00349325 predicted 1361
8 SASI_Hs02_00349326 predicted 1200
9 SASI_Hs02_00349327 predicted 947
10 SASI_Hs02_00349328 predicted 1813
11 SASI_Hs01_00228785 predicted 532
12 SASI_Hs01_00228789 predicted 703
13 SASI_Hs01_00228790 predicted 1699
14 SASI_Hs01_00228791 predicted 791
15 SASI_Hs01_00228792 predicted 700
16 SASI_Hs01_00228793 predicted 1607
17 SASI_Hs01_00228794 predicted 1727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215722 predicted 913
2 SASI_Rn02_00215723 predicted 925
3 SASI_Rn02_00215724 predicted 814
4 SASI_Rn02_00215725 predicted 1508
5 SASI_Rn02_00215726 predicted 322
6 SASI_Rn02_00215727 predicted 1556
7 SASI_Rn02_00215728 predicted 1422
8 SASI_Rn02_00215729 predicted 1339
9 SASI_Rn02_00215730 predicted 1505
10 SASI_Rn02_00215731 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016356
VALIDATED
DCDC2 MISSION shRNA Bacterial Glycerol Stock
doublecortin domain containing 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-1870s1c1
Sequence:CCGGCCTAGTGGAAAGACCAGATAACTCGAGTTATCTGGTCTTTCCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1980s1c1
Sequence:CCGGGAATTTGCACTGGAAGACAATCTCGAGATTGTCTTCCAGTGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-1750s1c1
Sequence:CCGGGAGTATATGGATCGCAAGAAACTCGAGTTTCTTGCGATCCATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-807s1c1
Sequence:CCGGGTACTACAAATGGTCACAGAACTCGAGTTCTGTGACCATTTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016356.1-1215s1c1
Sequence:CCGGCCAAATAGTGATGAAGGCATTCTCGAGAATGCCTTCATCACTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016356.1-795s1c1
Sequence:CCGGCAGTGGGATCATGTACTACAACTCGAGTTGTAGTACATGATCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016356.1-1332s1c1
Sequence:CCGGGCAGAAATAGTAGACGAGGAACTCGAGTTCCTCGTCTACTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016356.1-714s1c1
Sequence:CCGGCCGTGCACTATCTTCTTGATTCTCGAGAATCAAGAAGATAGTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1629s1c1
Sequence:CCGGGCTGATGTAGACCCTCAAAGACTCGAGTCTTTGAGGGTCTACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-713s1c1
Sequence:CCGGGCCGTGCACTATCTTCTTGATCTCGAGATCAAGAAGATAGTGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1060s1c1
Sequence:CCGGGTGGAAATGATCGCCACTCTACTCGAGTAGAGTGGCGATCATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016356
VALIDATED
DCDC2 MISSION shRNA shRNA Plasmid DNA
doublecortin domain containing 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-1870s1c1
Sequence:CCGGCCTAGTGGAAAGACCAGATAACTCGAGTTATCTGGTCTTTCCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1980s1c1
Sequence:CCGGGAATTTGCACTGGAAGACAATCTCGAGATTGTCTTCCAGTGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-1750s1c1
Sequence:CCGGGAGTATATGGATCGCAAGAAACTCGAGTTTCTTGCGATCCATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-807s1c1
Sequence:CCGGGTACTACAAATGGTCACAGAACTCGAGTTCTGTGACCATTTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016356.1-1215s1c1
Sequence:CCGGCCAAATAGTGATGAAGGCATTCTCGAGAATGCCTTCATCACTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016356.1-795s1c1
Sequence:CCGGCAGTGGGATCATGTACTACAACTCGAGTTGTAGTACATGATCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016356.1-1332s1c1
Sequence:CCGGGCAGAAATAGTAGACGAGGAACTCGAGTTCCTCGTCTACTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016356.1-714s1c1
Sequence:CCGGCCGTGCACTATCTTCTTGATTCTCGAGAATCAAGAAGATAGTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1629s1c1
Sequence:CCGGGCTGATGTAGACCCTCAAAGACTCGAGTCTTTGAGGGTCTACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-713s1c1
Sequence:CCGGGCCGTGCACTATCTTCTTGATCTCGAGATCAAGAAGATAGTGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1060s1c1
Sequence:CCGGGTGGAAATGATCGCCACTCTACTCGAGTAGAGTGGCGATCATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016356
VALIDATED
DCDC2 MISSION shRNA Lentiviral Transduction Particles
doublecortin domain containing 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154233    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-1870s1c1
Sequence:CCGGCCTAGTGGAAAGACCAGATAACTCGAGTTATCTGGTCTTTCCACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151230    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1980s1c1
Sequence:CCGGGAATTTGCACTGGAAGACAATCTCGAGATTGTCTTCCAGTGCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151206    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-1750s1c1
Sequence:CCGGGAGTATATGGATCGCAAGAAACTCGAGTTTCTTGCGATCCATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-807s1c1
Sequence:CCGGGTACTACAAATGGTCACAGAACTCGAGTTCTGTGACCATTTGTAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016356.1-1215s1c1
Sequence:CCGGCCAAATAGTGATGAAGGCATTCTCGAGAATGCCTTCATCACTATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152723    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016356.1-795s1c1
Sequence:CCGGCAGTGGGATCATGTACTACAACTCGAGTTGTAGTACATGATCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016356.1-1332s1c1
Sequence:CCGGGCAGAAATAGTAGACGAGGAACTCGAGTTCCTCGTCTACTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016356.1-714s1c1
Sequence:CCGGCCGTGCACTATCTTCTTGATTCTCGAGAATCAAGAAGATAGTGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1629s1c1
Sequence:CCGGGCTGATGTAGACCCTCAAAGACTCGAGTCTTTGAGGGTCTACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_016356.1-713s1c1
Sequence:CCGGGCCGTGCACTATCTTCTTGATCTCGAGATCAAGAAGATAGTGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016356.1-1060s1c1
Sequence:CCGGGTGGAAATGATCGCCACTCTACTCGAGTAGAGTGGCGATCATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks